Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30F8.1   

sjj_F30F8.1RNAiJA:F30F8.1
PCR_productsjj_F30F8.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF30F8.1 Source_evidenceePCR932WS150 Sequence/Annotation Release
Overlaps_Gene F30F8.1 Source_evidenceePCR932WS150 Sequence/Annotation Release
Chunk_score Abs_score808
Max_abs_score808F30F8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78340797835198
Overlaps_transcriptF30F8.1 Source_evidenceePCR932WS150 Sequence/Annotation Release
WB_DNA_textsjj_F30F8.11120aaatgcttggacggtagacgaggaagatgtaccaccttgttgaccagtttctgatgattcccatagagtacccattgaattcggaatgacacgagaattctaaaaaatgaatttaatttaaatcccattttcttaatttttttaaaccatttgctgttgatcaaactgatttgatgttccttgattcatactaagttcattcaactctcgccggagaagttcttccctctcttgggaacgtagacgagcagttaattcagtgaacatgttaggaaaaaccgtttgacccggaagatatggaagatcaatgttttcaatactctttccgctggcaatgaatggtattgttttatttggatcgatgacgtcattgttttgagaaatgttaatagcagcatcatttgactcagaaagccatgtactttgttcaatttgttctgctggaatcaatacacttggacgctgcaactaaaaaattttgagagaactgcaaagctctaatttaccgggaactgatgacgctggaccatttcaaaaaccccatcgagatcagcgttcaactcggaagacggaacttcaccctgattgttggctccatgatgaatatttaagttgttcacttctcttataatttcagctggagcttcatccactttaggctgaactgaaccgagtttgcgtgtctgtcaataaaattcattaaacgggaattaaaagttaaaaccaaccaggacaggaattgattgagatgaaagacgacgttgtgatgaagctgccaaagtggaactggaaggaacaagcgcagtatctaaggctgggacagattcggaattcgacaattcttggattgggagaagcctttgtgtgaacgagtttctcactccagcaacttgactactagtgggcacctctgacgatgtaaatgattgaatttcctgtcgaagagattgaggtggtacttcacttgagcgaaccatgttctggaaacatattttatcaatcagaatatgaaaacaaagtaaaaccgtttgcgcgatttgctgaggaacagaagtactggttggtagaactgcttcaccagagagtacaggtggaggaagcggctgggataaatctgaaa