Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F30F8.5   

sjj_F30F8.5RNAiJA:F30F8.5
PCR_productsjj_F30F8.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF30F8.5 Source_evidenceePCR699WS150 Sequence/Annotation Release
Overlaps_Gene F30F8.5 Source_evidenceePCR699WS150 Sequence/Annotation Release
Chunk_score Abs_score678
Max_abs_score678F30F8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI78479657848937
Overlaps_transcriptF30F8.5 Source_evidenceePCR699WS150 Sequence/Annotation Release
WB_DNA_textsjj_F30F8.5973agagatagccccaattagacctgaactcggtcttttgctgatttgaagtgcaaatttcaagaaaaaaactactcttcatttaaaaattacctgaatatcactgtccacttgtttcttcagttgcatcgctgttgccagtagttgaacattattctctgctgacgaaatagccgtctcatattgcccattgacacgtttcaaattgaaaagctttacattccaatagaacatttgaacatcattcagtttgacaagttcatcatttgccgtaaataactgacaaccaagatcaaactttctaatgacagcgttaattgtattgaatgtccatgcttctgttactgtcattttgtgagatcccatcgtgaattttcgtgtgatgtcacgtggaatatccgatgggaacttgctcagtagtttcagctggaccatatggacagccacataacgttctttattacgtgtcactgcgggaagcttcagaccatctatggtaacccaatcccaagatgatagagaggaaattagattttcagttccgtcagatgtactactagatgtacgaagacgttgaggaggtggtgacaggtttttgttgctctgaaattcaagaatctagctttctaggtttctagacgcaaagcttcaatttttcagtatcgacaaaacattttctattaaaaaaaaacctacatcagttctccttgtagaagttgaattattcatctgctgctcatttccaactgctccattctgtttctccggcgtagagcaatcagatttgatcacttcaacatcaatttcaggactatgggctcttggcgtcgcatcagtgtcctttttctcagcactctttaaagacgaggttgtagtagtgtccataatgtgtagaaacacaagcaatgctcgtcttcttcttctctgtcttccactcccccattcattttctgtgtgcatctgtctctccagtcta