Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F31E9.1   

sjj_F31E9.1RNAiJA:F31E9.1
PCR_productsjj_F31E9.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF31E9.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
Overlaps_Gene F31E9.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
Chunk_score Abs_score691
Max_abs_score691F31E9.1
Specificity_index0.818
Rel_score1
Map_statusUnique_ePCRV1732384617324985
C18D4.8 Chunk_score Abs_score154
Specificity_index0.182
Rel_score0.223
Overlaps_transcriptF31E9.1 Source_evidenceePCR754WS150 Sequence/Annotation Release
WB_DNA_textsjj_F31E9.11140agccaggcttcggatctaattatatacaatcaaaaaccaacctgcatgattatttctacatctttcttggaaaataaattcattgttacttcgatcaagtgaaactggacaagctgatttacgggaagaagttccagcgacacgatgctttgaattgtaagtgacttcgcttgcttccactgctctaattgaaatagagtaccggatagcttttcaatgttgccgaaactcaagtgtacaaactctttaactttgaagcaagccaaaaggggagccgcttcactggaagaacaattcaaaaactctacgcctgaaacatggcatttcatcaatttcaaaacgttttcaagtgcatcaaaatgtatttggcgagattttcctttcacggtgatattgacaataagtttttgcagtttgactttcgggttcgtcaaaaagatggtaagatcgatgagaataagttcaaatggggaggctttgctgatacttctgtgaagagaatttgcgtcaagagatcttccgaaacgcaattgacaaaatcctttgattagcttatatttcacctggtaattgtccaactctaagcttgcttcaattcctgacacgttgtagccaactgttttgattccatagtcctggttatcgattgaagcgcgcagcttctgattaacttttcgaacagagaatctgaaatcatttttatatttggtttgagcttatagagcctaccgataaaaactttctagcttgcttgtaatctcattaataacctccgctggcaaatcacataaggaagttgactttactttcttaaatctgcaaaaaatatcgaaacttcactttgtcaattttaactaaacttacttcatagtttttgtcaaattcacgtttccaatttcaaatcgttgaaaccagtaatcgaatgtctttttatcctatgatgtttttttcgagaattccgcaaaacctgttatatgcgatttcaacaggtttcttctgaagatattcaaataagatgctagcacggagtgcatgttgatcatttcgaagaatttcagcttttgtgaggtctctggaatgtgggaattttgttttattgtaacattcattaaaacttacagcttttctgcagcttttgct