Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32A7.2   

sjj_F32A7.2RNAiJA:F32A7.2
PCR_productsjj_F32A7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32A7.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
Overlaps_Gene F32A7.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
Chunk_score Abs_score650
Max_abs_score650F32A7.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1482835714829454
Overlaps_transcriptF32A7.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32A7.21098gtatcgattgtcggcgtttttctaacagttttccacttgatagtgttgactagaaaatctatgcgaatttcgtcgattatatcgattatgatagtcattgcaatgtgtgacttggtcttcatgtttgtggctatttcaattaaagacattgtattgaatcattatggaactttgtggtactttttcaaatttatattcatttttacgtttttattttatttttattttattttcagtactccatcaaatagtttactagtgcatcacgtctactgggttcttgtgacgtttcgagattacgccattaggtgctctacatggttaactgttactttggccatgattcggtttttggtatctaagtacataacgagtcctaaattacaagctttgtctagtttcaaagttggtcttcaagggtcaattatttgtctcctgttttgctctacattggctttgtgtaactatttaagcgttaaaatcgaaaaagttgactatttaaccgttcaacattaatgttaaaatctgagattgcagttgcacaaatatgcctttaaattcaacttatccatattatgaacatagagtgttggatttctttgcacatggaaatgaattgcctagaagaatgtatcaagttattaacggggttctagtcaaggtaagaaaaagttacattgtttttaagattagtatttattatacataagttccgaattacagatagctccctgtatcgttttacccctgctcaccacgttgcttgctattgaactgcgaaaaactgagagaaatcgaatatcatcacgtgtttccacaagaaacaagtcgagtttttctgattcatcctgtatgttctctaaaagaaagtttcagctcggaaagaacgacggttctagttatcattgtgactcttttgatattcatagcttcactgccaactggcaccgcaacagttttctcattcatctaccctgatctgggatttttgtgagtgttaagactatgtctaccgaaaaactacatggttttttgtttcagcttcctacctatgaatcttgacgcggcattacattctgttctggctctgaatgggtc