Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32B4.4   

sjj_F32B4.4RNAiJA:F32B4.4
PCR_productsjj_F32B4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32B4.4a Source_evidenceePCR718WS150 Sequence/Annotation Release
Overlaps_Gene F32B4.4 Source_evidenceePCR718WS150 Sequence/Annotation Release
Chunk_score Abs_score655
Max_abs_score655F32B4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1152521111526391
Overlaps_transcript F32B4.4b.1 Source_evidenceePCR718WS150 Sequence/Annotation Release
F32B4.4b.2 Source_evidenceePCR718WS150 Sequence/Annotation Release
F32B4.4a Source_evidenceePCR718WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32B4.41181gatcagagccgaaaaagcacttatagcttttcaaatgcaacaattggaaaagaagaagcttgaagcggagctccaaatagctcaaaaagctctgctcatgcaacaggctgcacttggcggtggcggagcactagtcgtcgacggtggagctcttgtcgctggcggtggagccgtaggatatcatcaccaggagcatcgttcgagttatggtggtggtggaagcagcagcaatggcggcagcagcaacagacgtcgccaaactcggagatcaccatcaccaccgcaacagcatcacagtagttcgagaagacagcgaagagatagcggcggagcaggtgagcccgggagccgggaagcaattttggatggaaatctcacctttggccaattttccagcacattttcagctttaatcggctgaaaatgttcgaaattgagcctcaaggtgacattttcagtgaaattttgctagtttttagataattttagacaaaaatctctaattttcaggccgttatcgccagtctacttcctcgtcgaactctaatcgcaatagcaacagcggcggtcgtaaccttgtagtcactgccaccaccaccaacaacaccaacgccaccaatgctggaagatcttatgggattcaatcggtgccagacgctagctcgtactctaccaacaactatcaacaacgatcgtcggccgcttctgcctatgatctacagattactgcaactatgccacaagctggagccgccaattctggagcagcatatcatcagccgtatggaaatgtttatcagcataatactggtgagcgtttttttttctaggcgaaaattgatggattattgatttttcgtcagagttatcgattttctgataaaaaaaaatcaatttttcactaaattatcgattatatgacgaatttattgatttttgaggaaattctcgattttgacgaaattatcgatttttgacgaaaatttcgattttttcatgaatttatcgtattcatctcctttaaactaaatttttgaccatcttttgtgacaatatcgattttcaatacaaatttcctcctaatttacaatttttcagccgcctatccagtgtggggaggacttgatgctcaaggacacatggcaatggacactaattggtctcaaaatgctgcaactcca