Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32B5.6   

sjj_F32B5.6 RNAi JA:F32B5.6
Simmer:F32B5.6:Repeat_b
Simmer:F32B5.6:Screen_A
Simmer:F32B5.6:Screen_B
PCR_productsjj_F32B5.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F32B5.6a Source_evidenceePCR808WS150 Sequence/Annotation Release
F32B5.6b Source_evidenceePCR808WS150 Sequence/Annotation Release
Overlaps_Gene F32B5.6 Source_evidenceePCR808WS150 Sequence/Annotation Release
Chunk_score Abs_score703
Max_abs_score703F32B5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI26689012670530
Overlaps_transcript (8)
WB_DNA_textsjj_F32B5.61630accaatgagaccttgttcgccggtctggcgttgtcgccgaccgagttttcgcggggaagcggttggccgatccatatggagaaggagcgacgggcagagtttaccgagttggtgcacaagaaggtggattcgaatttgttggtcgtggttgagatcaagatgaaggagtcgctgttcgagccattgaactatctgccggatgttgagacggcgtttaggagccagagaatcgagaaggcggtgaacaagtttgttgatgatgttatcaatggaaagattcggattcctgatttggagcacgtcgatgaaaaggtaagattttccaagaggcttaggcttgggcttggactcaaacttaggcttacaattaggcttagacttaggcttaggcttttgcttaggcgtgtgcgtaggcttaggtttaagctcaggcttaggctgaggcttagacatagactgaggcttaggcatagatataggcttagactcaggcttaggttcagacctaagcttaggctaaggcttagacttaggcttaggcttgggcgtaggcttaggtttaggaataggcttacgcttagactcaggctcatccttaggggtctatcttcagacctacgctttcccgctttccaattcggaatcaggctcaggcttttagttttaggatcagactctctggcgtagattttcaaaattaatgaggccacttttaaaccaattttttctagcaggctgacaaattctcggttcaccggctgattttcatttatggcgtcgactcggtatcgcgcgagatatcggacaacgagcaacaaagcgaaatctgtgagcaactcgtgagaaatgtaagtgttttgaaatccgaagcatatgggcataaacatgttgttcttctttttttgctttgttcttccaatatttggagacagagggggaaaagagcaaaagccatcgggcttgtctggaataagaaaaacatacatgtggaacacatatacggacgggggtcggattacggaaataaaaaagaataacaagactgcttatagacttgttttgtttataaatcttgcaatcagacacctccaacttgaatctcatgttacatctgaaaaatataattattataatataaacaacttccagacctttgctcacatctacttcgaacgggtgctctcccgagaaatcacgtactttgatgattttgtcaccctcgtcgagggtctcacctttgctcatctcccagctcttcggaaggaagtagaacgatttatttgccaaaaagttatcgaggtaccctataagcttctagtaattttaagcttcaataatataatttagattcaggctgatatggatccatcgttcgctaaaaagctactactggtttctgagaagtacaacttggagattttgaagatggtgatcaacgggttccttgtcgatcaaatcattggaaactcgaacccgccaaaagagctcgtcaacattacacatgagctccaacagatggcccatgagatgtaggtcaactagattaaagttgaatgtaaatcgaagagacaaatcattttcagccgcgaaaacgagaatatcgagaatcttgtcggagcagtcgtaacag