Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32B6.6   

sjj_F32B6.6 RNAi JA:F32B6.6
[cgc5655]:F32B6.6
PCR_productsjj_F32B6.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32B6.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (31)
Overlaps_transcriptF32B6.6 Source_evidenceePCR438WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32B6.6698gcatctcacagaaaacgaataggtttcctttgttactcaaaggtatcagaacaagtgtaaattgatgaaattattcaaaatagctactagctaaaactgattttttttcaaatttcaacgtgatctcctatttttggatgaacttccagatttagggcagagataagaaggctgctataaatttggaagattttgccataatcttcatagagttctcataactccttcatcgaacgaccatggcccaatccgtcccaccaggagacatccaaactcaaccgggtaccaagatcgtcttcaatgctccatacgatgacaagcacacctaccacatcaaggtgatcaactcatcggctcggcgtattggatatggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagctgtgcttcttgctgtttcctgcgatgccttcgccttcggacaagaggataccaacaacgaccgtatcactgttgagtggaccaacaccccggatggtgctgccaagcaattccgtcgtgaatggttccagggagacggtatggctcgtcgtaagaacctcccaattgagtacaacccatagagtccttgtgaaataaaagagttttttatgaatgcttgttctttctttgaaacaaaatgtagcctcacttgagct