Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32H2.4   

sjj_F32H2.4RNAiJA:F32H2.4
PCR_productsjj_F32H2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32H2.4 Source_evidenceePCR647WS150 Sequence/Annotation Release
Overlaps_Gene F32H2.4 Source_evidenceePCR701WS150 Sequence/Annotation Release
Chunk_score Abs_score596
Max_abs_score596F32H2.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89711758972170
Overlaps_transcriptF32H2.4 Source_evidenceePCR701WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32H2.4996gcagctgatgcttcgacatattttgaaaagtacaaaagaatcagatcaaccgatatgaaggtatacctaaagaaataatatatttcaagctttcccactcatcaattttagaaatgaaaactacttttctattccaggtccagcaatgccaatcaatagcatttaattgtgatggaacaaaacttgtatgtggtgcattcgacaaaaaagtgagcgttgcaaatgtggatggaggtcgtctcagattttcttgggtgggctctagtcattcatcgtctgtggaacaggtatatcggaaatttcctcatctggtgttaacgatttctatttcaggtagcatgtagtgaaaagcagccaaacttatttgcatcagccagtgcagatagaaacatttgtgtatgggacattcgacaaagcaaaccgactcatcgaatttcaaatcgaggtttcaaattaacaatttaaactcctaaaaatgatcggctttcagttggaaatttcttcatctcctggtctccgtgtgacgaatatttcatatttctcgacaaagataatcggataaatacagtagacattcggaattatcaagttgtaaatgtgagtttcaagagctatttagcaacttgagatttttaggattttgctaggattgcttgtaaagttgtaaagacgatcaaaacattttaaatttaattattttcagtcctatgaaatgaaaactttctcccacgagctaacatttcaccctttgtcgaaccacgtattcgtagcagagtctggaggaaaagttgaaattctaaagttcgccggtggagcccttgaacctgtgacttcgattcaagcccattcgcatcaagttgagtgtctggcagtgtcgatctcgaaagacgggcgaaaattggcagttggagcatcggatgcttcttgctcactttgggatcttgaagaactcatttgtgaaagagttattcctaggtaagcagcaggactgggact