Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32H2.5   

sjj_F32H2.5 RNAi JA:F32H2.5
Simmer:F32H2.5:Screen_A
Simmer:F32H2.5:Screen_B
PCR_productsjj_F32H2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32H2.5 Source_evidenceePCR1097WS150 Sequence/Annotation Release
Overlaps_Gene F32H2.5 Source_evidenceePCR1097WS150 Sequence/Annotation Release
Chunk_score Abs_score1055
Max_abs_score1055F32H2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89816588982810
Overlaps_transcriptF32H2.5 Source_evidenceePCR1097WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32H2.51153agcttcgtagaacaacactggagagcaagcattgtggacatggtattcagcagagcaagttgcagccaagtcagactcccagtcatcttctgggatggatgtagaaatccactttgaagatcttggttttggttctggaacagcagttctcatgcactcaatcatctcgtcttgaacagctagcattgctggggagtggaatggaattccagatgtatcaacaaccttcgcaaagatatccttctccttgagttgagcacagaatgtagctacaccttcagcatctccagaaatggtaaccgagtcagctccgttgtggcaagcggcaacaactccaggtggagcttgttccttaacctgctcccaagtcaaaccaacagcagccatagcacccttaatttcagtgtgcttcatgatggtggttccacgatgataagcaagtctcattgtttgctcacgagtaattcctccgtcagcatatccacatcccatttctccagttgaatgaccaattattccatctggtgaaactccgagagcagtgagaacatcagtcaaagcgatttggatagcagtgatggcgagcatgcagttcatagtgttgttggagtattgttctggatctggattgcagagcattccgtaaacatcaagtccaaattcttcaagggtcttgctggaagcacgaagagaatcatcgaacattggaatcttcatgagcttgatcgccattccaggccattgggatcccattccagagtaaatgaaatagatcggacgagcttcagtaattgggaccttggtgatgctcttcaaggtctcaacattattttctctatccaaaagcatgtatccacggaatggaagaaggttggctggcatgttagcctgattggccaacaaagcttgaaggtagagatcatccttgttactctcaatttcggtgaaaatgttttcaacagcttcttgagttcttccacagtaactgaaatattttacgttcaaaactgttctgaatctagaaatatatttttaacttacgtgacaagtttggtgaatggatgtggggtgattggtggagctatatgatcagcagccttcaagatgacgtgagtgttagatcctccgaatccgaaagagttgattccaataa