Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32H2.7   

sjj_F32H2.7RNAiJA:F32H2.7
PCR_productsjj_F32H2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32H2.7 Source_evidenceePCR929WS150 Sequence/Annotation Release
Overlaps_Gene F32H2.7 Source_evidenceePCR929WS150 Sequence/Annotation Release
Chunk_score Abs_score814
Max_abs_score814F32H2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89956938996880
Overlaps_transcriptF32H2.7 Source_evidenceePCR929WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32H2.71188gaaatctcgagagcggtacgaacatcctgagacgatctgctgaaatataatagcgtcaattaagatttcatagttaatacaattctcgcctcatatccgtcaaaatctcgacagcagtgagaacatcctgcgacgaacgaatcgattcaatttccttagcagtaaacacagattgacaacttccggatggagttgcaatactttgagccgtcaatactccagttgttggggattggatctcaatgcaagtctgaacatccttcgattcagtgtcaataagagaagtgttagatgaggaacgggcggtacgggttgacagaaggtttggttcagcgctttgagcagtcagcagtcctgaaaattttgacattataggcgatgtagcaaaatgtgttttgattaaaaaaaaatactttgataaagttgttcttttggtttcatcttcacattaaacatcactcaatgcttttccttacctggagactgagctttcaagttactgattgttgtcaattcctttgccggtttcacgctcaaaagattcggctccaacgagttggctgtgcgaacactcagaagatttggctcaggagattgagcagtcagcattccttccttcttagtaaaaactccaggactacgggccgagtaaacgctcaaaaggtttggctcaagtgagttggcagtgcgaatgctcaaaagattcggctcgacgctttgggcggtacggagagtgtcggtggagcgtccggtagcaagattgagctcggaaatagattcacgagctgtacgaagttgcgacatttcggcatcagaaaggcggtttttcttgacaaactctctctcaagacgctgacaagtggaaggtccaagaagagcaaccagctgggcaaaagtgaacttcattttactgagatcaactccctctggctttgaagctccctgaaaaagaaagttgttaaactattctagaaaaatttgggctaaccacattggtctcattcaaattcggattcgaaacgcttccttcaacagcagtacgagcatctgcgtctccatgagttgtgaagaacacctttccattgataatttgtggaatgacgattgcattgtccaatgattcgatttgagagctaaactcaaatattcacgtttattaaaacacttttcataccgaatctccttggc