Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F32H2.8   

sjj_F32H2.8RNAiJA:F32H2.8
PCR_productsjj_F32H2.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32H2.8 Source_evidenceePCR755WS150 Sequence/Annotation Release
Overlaps_Gene F32H2.8 Source_evidenceePCR755WS150 Sequence/Annotation Release
Chunk_score Abs_score619
Max_abs_score619F32H2.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI89907088992360
Overlaps_transcriptF32H2.8 Source_evidenceePCR755WS150 Sequence/Annotation Release
WB_DNA_textsjj_F32H2.81653gtacaatccccacgcaatcttgtaaaactttttgatgattctaaaagcaggagaattcgtgataagttggattgtttagagagaataattcgcattttgaaatgttgtttagaaaaaagaatgcaaattttgtcgattgtagcaattatatattttataaaaatgcaattgtaaacaaaaatttaattttcaattaaaaaaaaattttacacgatttttctatatacatagaactttctattataccaacaaaaacccccattggcagtttttctcagttaaacaaaaaacagttacagaacttggagtatttcgatcaattttccatgaaaagaaacgttcacaatgaaaaacgcgatataacagtattgataattgtgaataatttgggaagagcggaaagtgaatatagcatttcattgaatacagttcgatgctattgccaaaaacacaattatcgattggaaattgtagaggatactgaatttcgaaatttctgtcaacaggaaaatgtaagtaaaactattacacaatttaatttttttgcgaatggtctacctgaacatacgctctcccaaaataattatttcaaattcgaattctctaaaaatggtgtgctcccttaatatatacagtaatccattctatgtttccatttttgatcaagagaaaaacatgaaaagtttttgctgaaatttcagagcatgtaccgtcgccactgcatagttggtcatttgctccgtaacaatgatttcatatttttgttagatcctggaatgactattttgaatactgaaatgtgagaaaaatttacaaaaatgaaattattttaataataatttttttcagaagactagaacagtttaccgatgaaaagtatgcgttgactatgttcgataaattttccaactgggagattgaaactagtaagtgtttaatattttaagttactaacaagcaatccaaaaaattcagaaaattaaaattttaacttgtctcagattcatacgttgtcaaaaacacatattggtcccgcaacttcttgatgaagcttgcagactttgaatcaaagctccctttttcaagtacagataacgttgcaattcatgtaagaatttagttttgaaatctatatattagatataaaatttttggatatttcaattttagtatttttaaagcagagatggcaaatcaccggaatttcaaaaataaaaagcaaatttgataaatatttaatttttggtcaattgactgatttgccgcttgccaaaaatatacacagttggcaaattttcaaatcagtaaattgccgaaaaactatttgcctccaaactcatgaagtattcgaaattgagaaaatttttacttgctctctcagtaccaattaaactaaaaaattttcagattctcattcagaaagatttctatccacagttcaccgaagaagccgggacttgccttaaaattttggaaaatttggaattttccacttcaaattcagctattatgtacacattcgaggcatgtattcgagcagttatcggagaaaatcacgagttcaaaaatttaaggatacttaaaaaagtttgatttgtacctgttccaagcatatgtatctttaaaaaatattatttaacagggcacaggctg