Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F33A8.6_b   

sjj_F33A8.6_bSequenceATCGTCATGATTATCCCATTCAC
In_sequenceSUPERLINK_CB_II
PCR_productsmd_F33A8.6