Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35C12.1   

sjj_F35C12.1RNAiJA:F35C12.1
PCR_productsjj_F35C12.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35C12.1 Source_evidenceePCR150WS150 Sequence/Annotation Release
Overlaps_Gene F35C12.1 Source_evidenceePCR150WS150 Sequence/Annotation Release
Chunk_score Abs_score108
Max_abs_score108F35C12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI98047549805765
Overlaps_transcriptF35C12.1 Source_evidenceePCR150WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35C12.11012ttccagctttttaaaacaccaaattttattttaaaaattaaaaatgtcagctcgtttttctagttttccgtaagttattctattaaaaaaaaagtgatatctaccgaataacttgagctggaaatgtgattaattttggaaaaaaaaaattatatctatacttcaaaattacagaaagtatcaaacttatatttttattttttcggtgatttcaccaaatgctttttttgccaaaacttttacatagaatataagacaaactctcttgaactagaaactacgaaaactttgacttttcgttgacatttctctgattaatcatccttgcactaatgagctagacattctgcttcctttttaccttttgtgacttcattctttaagatgaactttattttcttttactctttttttcctcaaaccccgaatttccatcaacttcatccgtttctggtcttctgcctcctgcataatcaatttgcaggtctgggggaccccttaaaactttttatttttttcaagtattgttgacgtacccacccaaaactattacctgggaagccttttgtggtttgtctttttccattctccgcccatttttcttttccaaaagggatccttacttctttttgtcaatgttccgctcgaatagtcgtcgacttgaaaaggcgctttttccctccttctttaaagagagaaaaaccaaaacttcttcttcttcagcttctgcatctttcatactttttcactttaatccttattctgtttctctctccaccttcgtccacaaaaatttttttgcgctccaaaaattgccaatcctcctcctaagctgattgtcgttcgaaagcatcgtgggaaagcgtgggagagcctgattgtgcaccattggagcaatgaaaaaaggaagagcagagaagacaatgatcagacatctaaatgatgacgaacaagaacaatgaaataatttgaaaataatttgataattttcttgaactgaacatttggaggt