Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35E2.3   

sjj_F35E2.3RNAiJA:F35E2.3
PCR_productsjj_F35E2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35E2.3 Source_evidenceePCR238WS150 Sequence/Annotation Release
Overlaps_Gene F35E2.3 Source_evidenceePCR527WS150 Sequence/Annotation Release
Chunk_score Abs_score485
Max_abs_score485F35E2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1173480411735985
Overlaps_transcriptF35E2.3 Source_evidenceePCR527WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35E2.31182gtaggtaggcgtaaatgggattcaaggcaagtcaaggcctgcctgcgtgtctactagcaggctgctcaggccttggtcacagtcgaaggagacaggcgtagttttgattcaagatagacaggtcgcctcgaaagctggcatgcgtcggttgacaagaaggtaggcatataggcccagccggtaggcaggcgtaggtaggcttcaaggcaagaagatattggttgcacccaaatgctcaaaccaaccatcgtccaagcatggataactggtgaaaaccggcgaatcctgattgatttgaatgatcattggatgggaatatgtcgtatttgaagattccagacatccattcagaatcactgccttgcaagtataaatgacattttcgggcagtaggacgggtgtggacagacttttccaataattctcaacgtggaaagagcgttgccggggacgttgatgtgtctggaatgagaattgatttgtttctacctacactaggcattcaaccgagtcgaggcgccacgtggtgtcaggctgtctcattgcggtttgatctacaaaaaatgcgggaattttttccctaggaaaatgtgacgtcagctcactcttaacaatgcaaaatcagttgaaaagtctgcgtctctcatcccgcatttttcggagatcaaactaaaatgggacaatttgacaccacgtgaggtgccccaccgagtgcagacacccgaatctcaactcactttgtcccactcttctcgcattgaactttaacatttccttcatcgtaaatccacgtgtcaccttccataactgctcgggaagagctcaaaaaatgacgagtagaaatcatgctcgcagttgtgacaatttttgagtttgccatactattttccagagtaagcgtccatttggctgggtcaactttgaacgatactccgtctgtgaagcggcgggctgaaaataaacgtttttaaattttttgagttacctgcctgcctacaatgcctaggaagtttttaaaaactcacgaagatgctcctgtccacatgacgctagacgttcatcgttctcctcggcagagagcttccagaattgctcactttgcaccaaaatgatggaaattgagaatatgaatatcgattttattttcatattcgatcagcgttggatttttgttggaataaa