Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35E2.8   

sjj_F35E2.8RNAiJA:F35E2.8
PCR_productsjj_F35E2.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35E2.8 Source_evidenceePCR771WS150 Sequence/Annotation Release
Overlaps_Gene F35E2.8 Source_evidenceePCR771WS150 Sequence/Annotation Release
Chunk_score Abs_score708
Max_abs_score708F35E2.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1171881011719769
Overlaps_transcriptF35E2.8 Source_evidenceePCR771WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35E2.8960gcctgagagaacctgcaaagacatactgatcgataattcagtcccctttgtgttctctgagataatccattactcctccattcgtcaacatggcccccttcaatcttctccgtcttccaaccctcatcattagtgaagtgatcagatcaatgaatgctctggaattgtaagtttccttttttgttcggattgaaaaattgaaaaatttcagagttggcctctcggaaacatccaaaaaatcgcagatactcgttaaaactctcttaaagaattcccaatttcacatgagaatttgtgagcaccctgcagccattgcagtgtgcataaattccaaaacatctcagtcgagattcgaattgaggcacaaccttgatctagcatttctcagaataaagtttttcctagacattttcaatgtgacaacagctggactgttgttctgtaacccaacggagaagagtatccgagacactttaagcctccttgtcccaattaacccaaagtttatcagcttatcgatttctgaaatggaatccatgtctgaaagtttattcgagtacttgttaagtatcaaggcctgtcggttcattgttaaattgaatagttttcacgaattaacaccaagcaattcaaatttgcttctagattgtgtttatgtgaagctaagaaatctagctttcccagatcagaaaatgattgaagtactcaaaacctggaaactaggatgtaatctcaagtcgctggaaatgtttagttcagattatacatgcgatttcaatgaacttgtgaaaggattggatacacaaatgtaagttgttttgtttcaaataagaaaaatgaaccaactccctcgttttttacagaattgatgctgattctgaacttaagtgtcaaatcgagcaagctaatggaaggattggacttttgacttttgaaatatggggacaccttcacttgaaa