Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35E8.13   

sjj_F35E8.13RNAiJA:F35E8.13
PCR_productsjj_F35E8.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F35E8.10 Source_evidenceePCR710WS150 Sequence/Annotation Release
F35E8.13 Source_evidenceePCR710WS150 Sequence/Annotation Release
Overlaps_Gene F35E8.10 Source_evidenceePCR710WS150 Sequence/Annotation Release
Chunk_score Abs_score626
Specificity_index0.484
Rel_score0.937
Map_statusBest_ePCRV1592198115922890
F35E8.13 Source_evidenceePCR710WS150 Sequence/Annotation Release
Chunk_score Abs_score668
Max_abs_score668F35E8.13
Specificity_index0.516
Rel_score1
Map_statusBest_ePCRV1592787015928779
Overlaps_transcript F35E8.10 Source_evidenceePCR710WS150 Sequence/Annotation Release
F35E8.13 Source_evidenceePCR710WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35E8.13910tgctcatcgtctcaagttggtcaaagaggtatcaagaaatcagcagattctgcaagtagtcgcacagtattgtcttctctgtgcgagagtgtagaaagtgttggtgcagaagttctttccagcccaggcagcacatgatggactggtatcagcgatgaaagaagaacaggttccagtagaagcagatgatcgggtagttgttgaagatgcacattttccacaggttctctggcagtaggtggccacaaaggtttcgagtccagcggcggtgcaaattcttatgtcatttgcacagtcgggaatagcatcaacgcatcctccctcattgcagaatccgcaggcagatggacagtccgcagcgataattggtctccaaaccggtgacagacattgggaggcggtgatggtgccacagttgagacgtggatctgaaaaaacagaccagttagactagatagcatcgattgtctttggttctctattttctagaacagacaagattacagaagccgtagaactactgaagcatgagtttgactcacatgcaacatttgggcagttgtaaccagaagtctgacaacataatccgcaagttcttgggcatgtgctctgagctgcattcttcatgtcttgaactacagcagctggagtcgcggtagcagtcgtataacaagccaatggtctctgctgatctcttcctggtgatggatatccgtcagctgcaactggggcagggtacagaactgcgcaggatgaatcggagatgacattgctgcatgcagtggcagctgcgttccagacaaactgaaaatcttaagatgcgtaaaagcggcagtatcccgaaaacttacagcagttccgttgtaagatgtacagttaagatctcctccaatgactgcactggcttgtg