Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F35G12.5   

sjj_F35G12.5 RNAi JA:F35G12.5
PF:GL1_3A11
PCR_productsjj_F35G12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35G12.5 Source_evidenceePCR818WS150 Sequence/Annotation Release
Overlaps_Gene F35G12.5 Source_evidenceePCR818WS150 Sequence/Annotation Release
Chunk_score Abs_score671
Max_abs_score671F35G12.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII45853344586522
Overlaps_transcriptF35G12.5 Source_evidenceePCR818WS150 Sequence/Annotation Release
WB_DNA_textsjj_F35G12.51189atcaggactttgcgcattcttcgacaaacctgagcacgccatcaccattggaggaagaatcggcacgcgaaaacaatcacgaggctcaggtagaatgccgaagttttggaaaattaaaaccaaacgggttaccttcaggaattggatataactgaaagaattgctcgcatgaatctcataggagggagcgagttccaaatgcaatattcttctttccttacagcagtgtcaacgaaaccttcaacagatgctagtttgaaaaagtattttatcaagcaccttatgcattttattattcggttttctgtagggaagcaagacgactcgctgaaatttggtgggcaaaaaatttgagattttttccgcaaaccatgtacgtgctgcagaaacttgatcagaaaaatccagatgggtttaattacactgattttgaggaagaggttcaggtaataatttaatcttattgttaaacaagggagaaatttagtacgtttagaaagtgatcccaaggtcctggatacagaaccatcattcatttacactcttgtcgctgttgaatgaagagagcctttacgtgaagttcaacttgataatgccctcggattctgagaatatgaacagagtaagctattatattttgattggtcaagaaagtaaatcaatatttttaaggtgaaggtcaaccaagtaattaaatttctcggtttccatgaaattggagactgtgagttttctatgatctatcaatatgttagttcaaagtccgcttcagaatctacatacagcatccacaaagtgagagtttttttagtggatttcttttcaacttcgaattttcagttcatgtgtgaagactttccgggatgggagacacaatacaataacgaaaagaaaagcatggataggatctttgagataattattcaggagcaaaaagtaagaatgattgaacatatatgagaaaacatttcaatgtttttcagttattttggacggaatatgattatcatacatacaaacgccatgcatacaagattgctgtcccgatggtcttctcgcttaacattgtagacaaagctgttggagttcgaagtgatgctcgctagctagttaatgatagccctgtctttcccgttcaactcgatctctttgaaaaaaattcattaaatcacatcagaatcgctcgaaa