Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36D1.1   

sjj_F36D1.1RNAiJA:F36D1.1
PCR_productsjj_F36D1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36D1.1 Source_evidenceePCR567WS150 Sequence/Annotation Release
Overlaps_Gene F36D1.1 Source_evidenceePCR567WS150 Sequence/Annotation Release
Chunk_score Abs_score506
Max_abs_score506F36D1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1127745611279099
Overlaps_transcriptF36D1.1 Source_evidenceePCR567WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36D1.11644actactcccgacttctcacttccaaaatattaccttcttcctgcccggctgctcatcctcatcttccagctcctcttccaacccacttgacgacccatttgggcttctagtcggactatagtgaacgccacgttttaaagacgtggatgacgtcacgaatgttgatgatgacgtcatttttggttcattggagcacgtagcaatctgtgaggagtcaatcatcgactgttgtgataattgcggtggaggttgattattgaacatttggaacattttctcctcagttgatgtgggctcataggagatttgtgctctgaaaagtttagatttaaagaaaaattggtggcctagaaattggaaaacttcggccgtgaatttttatgaaagttttttttagtttttaaaccactcaaaaatgttgattctccgccgaggtatagctcaataaagttgctggcctagttttggaattctaggccatatgtacctgaaaactaggctaccgtggtatttttatttcaatttttgaaaaaaaattgagaaaaaagaaaaaaaaaatttttcaaattttttcaaactcttgtaacttgttcaatttttgcccgtttttgcaaatttttattacaaaattaagctaattgtttaaatttacaacattttaaaagttagccaaaaaaaaagtcttccgaattctgaaaaaaattgaattttttttttgttttttgaaaaaaaaaattattttggatttttgactttttttttcaaacccttgtaactttctcaattttcgttttttttcggagtttttttgtcacaatgactcaaattttctgagttttaacgtttttttttacaatttgacggttgggtccccccacgaaaaggagtactgtagttttcgtgtcgggagccaaaatagtccaaacctagtcatgattttacgtaaaaaaaaaagctcccgataaactgattacgaattttattgttttaaaatgtaaaactgaaatttccatgaatttttaagactttgggtcctaccacgaaaatgaaagagtactgtagttttcgcggcgggacccaaaaaagtctaaacctagccatgattatacttgaatgaaagctctcggtgaactgattacaaattttattctctagaaattaaaaattgaaaaatcataaagttttgagactttgggtcacgccacgaaaaggaatactgtagttttcgtggcgggacccaaaatagtcaaaacttagtcatgattatacttaaatgaaagctcttgttaatctctattcaaatttttgcgtaaaatccaaaaaagcacaaacctctgcccacacgacgtggaattcggggccaactcataggtgtgctcacacgtgtcgccgagccttttcgcctccttctcatctagaaaagtgagcattctataaaatttccaagtgggctctttcatcgcgtcttccatatattttccctcgtgaacccatcggagcttccgtacaaatgtgtcttttagatttttccactgagatctgacgtcttcacacgtgaattttatgggcatttgaaacattgaattgagctctgacgtcacttcacggaggcaggaggtctggaaacggagaaaatcgataatt