Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36D1.3   

sjj_F36D1.3RNAiJA:F36D1.3
PCR_productsjj_F36D1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36D1.3 Source_evidenceePCR738WS150 Sequence/Annotation Release
Overlaps_Gene F36D1.3 Source_evidenceePCR738WS150 Sequence/Annotation Release
Chunk_score Abs_score633
Max_abs_score633F36D1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1128887211291363
Overlaps_transcriptF36D1.3 Source_evidenceePCR738WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36D1.32492ctgaaaataaattccgctttcaaaacttccttaaaataaaaaattttggaaaaaaaatttttgaaaaattttggatttttttttgaaaattcggaaaaaaatttttattaaaatttttcaaattatacccaaacttcctctaaaactctaaaaaattccagaatggacatctacaacaaatccgactacatttcctacaatttccaatggaattctttggatttccctaaaataacagtactcctcggccctttctacctatttcccactttttatatagtaggaaaaatggcaaagttattttttgacgcaaatcagacaactatggcgtcatcaatacaaaaacacctttttatggcatttttattcatgcaaattgcggtgagttgggtctcgacgcgaaaagtgcagtaacccaggataaataaccatgttttgaaaatgttaacaaatagagcttaaaattttaaatatagcactcttttcaaaaataatgattttcagccgagttatgatcatttgaagttggtggcctagaaatccaaaactaggccaccaacttcaaacagctgtaactcggcggaaaattgatatctttgagtaaaaaaaaataagataatgataacattttttcttttattttttatgaatatttttggtggcctagtttttggatttctaggccaccaaacataaaattcaaaaaaatcaaaggtatttcggtcgagaattcaaatttggacacaaaaaaatttgatactttcgctaactttcccgaaaattcattcaaaatctgtctaaaatattttttttcagaatttcttctacataatcacggatttcattgtagtgcgaattccagcaacagggattttgacctcaatttgtgctcaaattgctccaaaccaagtcctgaagcttccctacctgatcgcattcatttcaagttatgtctctatgcttttccctgtaattttttgtgcaaatcgggcgattatagtgttttacccgaaaaatcataatgaggtaagtcgaaattcggattctacgtaagatttctgaaattttaagccccatattgactatgttctgacttttttgaaatttgttggtctggaccgcgacgcgaccgcaacgcggctcaaaaaattatttgtctttagaggaagttttgtgtatatttcaataacttgacatatgaaagtctatgaaaaaccgggaaaaataaagaaaaccctggaaaaaatatttggaaagagacgcgcggcgcggtcgcgtcgcggtttccctctaaaatcaaatttatcagaacctagccaatatgggtgtcaaaactttgcaatttttacgtagaattcagatttttaaagtaaaacttttgaattttcagatttgccgacgtttcatgaaattctcactgccaattactgtaattcttccgtgctgcttcacatttttcatggtccccgcagtgggacactgtacccagcttactgcaccgtacccaatgggcgcagtaatgtttacgttagatttgaaagtggtatgtctaaaaagcgaccgcgttgcagccaaacgagtaaagttgaaatctgtcaaatttgttttcaatcgattttcaatgcgaaattcgaattctccaataaaaacccgaaattttaagccccatattacctatattccaagccatttgaaatttagcatgtgaaccacgacgcgaccgcgttgcagccaaaagagtaaagttaaaatctcaaaatttgtttttcatcgattttcattacaaatttcgaattctccatcaaaaatccaaagttttaagccccatattgtctatattccaagaattttgaaatttagcttgtgaaccgcgacgcgaccgcgttgaagcttgacgaaaaaccaaaatcacttaaaattgatttccatggaatttcattgcaaaattcgaattctccattaaaaacccgaaattttaagccccatattgcctatattccaagccatttgaaatttagcatgtgaaccgcgacgcgaccgcgacgcagcagaaccaattatgacagaattcacgattccttgcgaatttaggaattttcatcaacaattcaaaattttgtgttccatattgccaaagccctgtttaaatgataaattttcactcgcgtcgcggctgcgtcgcggtcaaaccccaaaaaccaacttcatcgtaacctagccgatatggggttcaaaaatccgcaaattttacgcagattccaaattttctattgaaaatttataattttcagcgtatcaacgagtacacccacctcctcacctcatttttctgcaccctattcacattctccataaatatcacaatgatggttaaagttagacatattttgtttcaaaaaaagtaagttttcaggctttataattgaaatttataaggaacttttagatttttcaacagaaatatcaataaaaactacaaagcggaaatgtca