Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36F2.3   

sjj_F36F2.3 RNAi JA:F36F2.3
Simmer:F36F2.3:Screen_A
Simmer:F36F2.3:Screen_B
PCR_productsjj_F36F2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F36F2.3a Source_evidenceePCR593WS150 Sequence/Annotation Release
F36F2.3b Source_evidenceePCR519WS150 Sequence/Annotation Release
Overlaps_Gene F36F2.3 Source_evidenceePCR616WS150 Sequence/Annotation Release
Chunk_score Abs_score490
Max_abs_score490F36F2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90126919013872
Overlaps_transcript F36F2.3a Source_evidenceePCR616WS150 Sequence/Annotation Release
F36F2.3b Source_evidenceePCR542WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36F2.31182attgcgtccggatcatctaccgttgtttccatcaactcttgagatggtataccagtggtacgttttgtgttgagctgaaaaattgaacacttttgctgaaatttcaaactactattgcgaggcggcggctactgatgattgcacgctctttgacgaaatcggtctgcaaattgattacgaatctaaaaaaaacatcgaaaaccaatagaaacattattagaaaagtcccaagaactacaaaaatgggtgttttatcttcgttcaacgcacacacacaatattggatacaaacgagcaagatatagctcatatagatgaaagaagagctccctgaggaggtacaaaaaagaagaggggttgtgaaaagtgaagccggtttaggcattaccatcgggcagtttttgtaccaatgtcctggttgactacaacgattacatgtatatgttggtggaggtggtcctgtcataatgcctggctgacggcgacgaaagctgaaactggttgaaattaaaatagttcttactattagatcaaagtaggtttttcaataaaaactaatgttttcagtgcaaaaatagagggaaagataatcttactttgattgatcgtatgctcttgtcgactggtctctgatatgattgagacgttctgcttcgtccatgttttcaaattctgcctggaaagaaacaaactatttgacagcattattaatcatttacataccgatgaaatatgagaacttggatcaagaaatgaagaagtagcatccaactgattaaccataccagaattcactccagctcttaaaattgattattttatttgacttttacgctctcaaacaataaacttactggactttctgtacttttgcggcgtccttccgagggaatcgttgaactattatagacgaatttctcgggatcagctcatcgtcgctgtatgtcttttttgtgtgagcattctaaaaacaaaaaattataaatagattaataaataataaataaattacctgaagctgcaactcgaagagttccaatttgagattctccttggcacaaatttcgcggacaagttgctcgccacgaatatgcagtccgtcaaactgcagtgtcttgtaatcaagttccgcacggaacttgtagtgaattgacgacatttaaaaaccctcgttccgaaact