Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36F2.5   

sjj_F36F2.5RNAiJA:F36F2.5
PCR_productsjj_F36F2.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36F2.5 Source_evidenceePCR733WS150 Sequence/Annotation Release
Overlaps_Gene F36F2.5 Source_evidenceePCR733WS150 Sequence/Annotation Release
Chunk_score Abs_score628
Max_abs_score628F36F2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI90241749025366
Overlaps_transcriptF36F2.5 Source_evidenceePCR733WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36F2.51193tctacacctggcagcaacagaaaactttaggtataccttttttcatttaaaaattttaaattgctatttgtccctctatatttttacatttcagacgaaaagaagctcatcgaaaaactgcctctcaagctacaaactgatctggctttgtctgttcattacacaactttgagcaaagttcaactattccaagactgtgatcgtgctcttctgagagacttggttttaaaattgagacccgttatatttttacccggtgatatgatttgtttgaaggtttgtgttatttcatttcattttgcttattttcaaaataagattttattaaatattattacagggagacgttggaaaagaaatgtacatcataaatcaaggaattcttcaagtcgttggtggagatcacaatgagaaaatatttgcagaattagcacaaggtgcagtatttggagaaatcagtctattggcaattggtggaaataatcgaagaactgcatcgatccgtgcaaagggttactgtactttgttcgttttagcaaaggaagacttgaatgatgtcatcagatattatccacaagcacagacaattttacggagaaaagcagctgctatgttgaagaatgataaaaagagtgatgaaaagacagaaaagataaaggcgcaagcagagttagaagatagatgtaagattaatccaagacaagttcctaaattgattacggtaaggaattgttttaaaccggcaggaatatataattgaaattttcagttgattgctaatatgacagagatgaatgaaaacaaaggagttcaagaattgaagaaagttattgaggaagaaacaggtaatagcatttaaatttcacaaggactcggtgttttgaaaacatcctagctgctcttttacagtttttgaattttcagaattcttcggcaaacttcgccatgtatctttagaaatttagttagagttcaaattttgagcccacaaaatatcaaagagagcataatttattctttagttgccgtgttgtctttatgttagattgaaaataatagagacatcgatgtattttgacggacgccaggtttttactgttttagaatatgttacaaaatttgattccagaaaagtcacgccggcaatcgatatactatccctggagtactctacaaagagacgatgacgacga