Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36G9.13   

sjj_F36G9.13RNAiJA:F36G9.13
PCR_productsjj_F36G9.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36G9.13 Source_evidenceePCR1136WS150 Sequence/Annotation Release
Overlaps_Gene F36G9.13 Source_evidenceePCR1136WS150 Sequence/Annotation Release
Chunk_score Abs_score1094
Max_abs_score1094F36G9.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1598701915988205
Overlaps_transcriptF36G9.13 Source_evidenceePCR1136WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36G9.131187tgggctgcatctaggctactcaagcatcttaagttatcctcttactaactccaagtttgacagtaacgcaaacgctgttaacaacatcactgcagtagaaaaaagcagcattattctgatgaaggatgtcgcagttgcaccgttttcgcctgccaatcgtagcttcacagcgggctttgcaaacggattttccgatatagaaaagctcactagtgattcgaaagatcgttggcttcacagtcttctcgaaccgtctgttcctttgagtggcgtcaaaacattgacaaactttggttctgaattgagaaaactcgatgacaaatggagaccagttaccacggaaaatcattatcacacgatgaaaaaaatgtctgctcttcaaaatcatcttgaaaaaacaatgacatcaaaaaaaattaaagcgaccgtcgatagaataaaagacaactgcggtacgggagatgctgaggacggcttaacaagaaaaatcagagaaggagttgataacgcagctttgcttctaaaaacgctcaaagcaattgaattcatttctaatacattaaccaacaatgtcgtgaatgatttcaaaaaactttctagcaattccaactcttctgaaattcagaaaattggcaccatgttgcgctctttcactcgaagtttaaaattgatcgaggaccttcagcaacatcttcaggatcgtgttaaaggagctctagagttaaaattcttccacgatacaaaaataccatctctgattgcccacttcaactgcctcaaaaacagacccgacgataccgaaaagattgcctcaactgtaagatcgatcaggattcttcgaaaattgaaggcagattcgagttatatcaataatttcaatgagatgtcatctgttctgtcgggatcctcacagtttattgtatcactacgcaaaactgttgaagagtacaaaaaggataacagttccgaagtgattattctgaaaaaactgaacgccttgaaagatctttcaaaaccgtttggtgatgccattggagcacttgtttcaatcaaaaaggctagcagcggatcagagttgggaactttcgtgacaaatggagagtacactcaagagatggttcccaggcttggcactgcggagctcaaaacgcagtttgaaaaatattggggagattttgaggcaacaa