Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F36H2.2   

sjj_F36H2.2RNAiJA:F36H2.2
PCR_productsjj_F36H2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF36H2.2 Source_evidenceePCR705WS150 Sequence/Annotation Release
Overlaps_Gene F36H2.2 Source_evidenceePCR705WS150 Sequence/Annotation Release
Chunk_score Abs_score602
Max_abs_score602F36H2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI92476659248844
Overlaps_transcriptF36H2.2 Source_evidenceePCR705WS150 Sequence/Annotation Release
WB_DNA_textsjj_F36H2.21180atgttcctccgtttgtccagaattatcagagtcaatcggtggaaaatggtttgcctgtgcctcaatactaacttcttcttcattttcaatcaacccttctgatccatcatcagttatcattggaggcgtcaaagttgtaagatagtaatatgttgctaaactgataaagcacataattaaactgaatccaaaatacatttgtccattgagaatcacatcggaagtcactgcttgacagagaatactcatcaatgcggcaagtacgccagcaaatgattgaccaaccatcaccgcttgagtctgaaatttattttgaaattacgagaaagatttttttcattctcgacgcgcaaaaaagtttatggtaattattttttgaattttgcggatgcttcctcgtttaatctccttgcatttttgaagacatcacttcgttctagcgagttttgtcgctttcttttgatttgtatgaagtaatttaattgaaaaaacgcaaggaaaataaacaaggaagctttttcgcgcgccggggtccatctaaataaatctgtgcgcctttaagagtgcatcgcgtgaatttgtataataaaactgacatattgtgatgggaaaagagcagaaagtcccaaaacacctccagccatcaatccaagtgaaccaaagcaagcaattgagatgagaatcattgaaagattgaagaaaaacgtctgatcatcatcaaaattccaaaatgtcaaagcgattgttggaataaagacgacgacgacaagaatgtgtccccaaatcatacgggtactgtttgacaggctgaaaaaattatatatttttcgaaaactctaaaaaaaggtgttaaaaatttaccttttcgttgcaaaaacgttcagaatagatccgagaacacatgctatactcccataaacagtgagatacgcttcgaagttagcttgaagctctgttggaacatcgtcacggactgaaatttgtatttttcagagcacacaattaggattttactcactttgtcgtttgataaaccatgtgtccgtcgtattgaccgggtcctcgtcgttggtgacatttcgcagcttatagtagaaatactggaaaaataaatatttttttctagagatttggagtaaatttgtgtagaaaaatcatggagatgactcataatgccgcc