Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F37B12.3   

sjj_F37B12.3 RNAi (6)
PCR_productsjj_F37B12.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF37B12.3 Source_evidenceePCR899WS150 Sequence/Annotation Release
Overlaps_Gene F37B12.3 Source_evidenceePCR1046WS150 Sequence/Annotation Release
Chunk_score Abs_score942
Max_abs_score942F37B12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII90399179041572
Overlaps_transcriptF37B12.3 Source_evidenceePCR1046WS150 Sequence/Annotation Release
WB_DNA_textsjj_F37B12.31656gaatggaccgaacaagaggaaaaaaaacaaactagctcgcaacaaaaaattaacgtttgatatctatgaaactgtgatagattaaagtaaaaggagataatgaaaggtaacggcaagtggaaatcgaggaatgtgcgaacttagaaattactttccaacacgaatatcacgttgactgaaagcttcaatacagtagtcgagtcctcgtcgtgagcatggaagccgtggtgactgcaggaattcagttattcgaagattccaaggaggataaccgcataatgtaggaacatttccaattcggagtaaaaagtctgggtcactcaaatgaaacttttcttctagaattttcgatactttctccacagtaatcggttcgtcgtcacgacataactgtaaaaaaatatgttacgttaaatatggctcgctccttaacttacagttttacatgtctccacaagcgcgtctttgcccattttccttgataatacgttaacctgaatactagcaagatcgtcagaatgtacaagtcggccatcgcagtagagatcagctcgctgaaattgttcatattcgatgaattgtatgaggttacaagcataccgtgaaaatgcgacaagcctgttcaatctgactaatttggttgaccaggtctccgaatggatcatagattgacaattgtcgaatttccgcagaaacacaactatccattagttgtattacttcggtctgcaacaataaaacgttgaaactttttttcttgaatttacgttttttttaaattttgctcatcatcagaaaaacgttttctagacaagattttgtgttaaatacaaaacatgtacgctttttaaatttctatcgacttttgtatttttcacatgatttgtcaaaatgtatgaattttgcggttataaatactttttattgaaaaattataaaaaattgataaaaattccggagcaacaggaattcagcacactttgaaagcccataccttatggaatttaataaaaatgtgtggctgtatttttacgcaaaatttgcaaaattttcagtctgggtaattttttaaaaactagaaaaaatacagttaaatttttttcaattaattaaattaaaaaatttagatattatcaaaatttataaactgacatgtgaaaactgctagttaaaaaaaattaggtttaatttcaagataaaatgttaccaagtcgatgagacgctcctccgtgaaacagacagctaaatgagtgggaatccgtattctcacattgtccgttttcctattcttcatggcgatctgtgcccacaacggtgaatatcctaagaagttgcatacgagcatcacgagccaatagacagcacgaactgctccaacacagatccaccctacatctagcatctgaattcgaattatcatatttctgagatacaacttctcaaattgattttgcagaaaaataatgtttggcttaaaaaaccgatacagtatgtagaaacgagaattttgtaaatacagttcattcgtatatgaaaaaatgagataatattcaggaaaagccttttcacttttttgaaagcaaacgacatgtttagccgaggcttttgaggaaagaaaggctaaaaagggagagatgaatgggaaaagacacggaa