Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F37E3.2   

sjj_F37E3.2RNAiJA:F37E3.2
PCR_productsjj_F37E3.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF37E3.2 Source_evidenceePCR737WS150 Sequence/Annotation Release
Overlaps_Gene F37E3.2 Source_evidenceePCR737WS150 Sequence/Annotation Release
Chunk_score Abs_score653
Max_abs_score653F37E3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64268826428008
Overlaps_transcriptF37E3.2 Source_evidenceePCR737WS150 Sequence/Annotation Release
WB_DNA_textsjj_F37E3.21127aacatagccatcacttcgggaggcatagaagaacttctatgtaacatattatttgccacattcaaacgtgccaaatgacagtttgcagtaactgcttgaggtatttttgtaagattacacgagtccatatcaagataacgaagagatttcaatggaacaaatgaatagggagatatcgattgaattggcattcgggaaagtgaaagagttttcagagcattcaaaccatagaaatgatcaggtgttagcgtctgaaaatgtttttttgtggggatattctcggaaaacttacagtaatattggttctgcttaacttgagccatttcaattttatattctttgcaaatggcttgtaagggagcattttaattggattccctgtcagatcaagtacacggagatcaatgcatttactgaaagtgtgagatgcaaatgatgttatctggaaacttttttgacttttctcctcttgaggcgttgcggggcgcatctcactcgccttcctagcgccttattggagtgtgcaattttcatttctttattttcaaaagcgttttccggaagaggaggcgagggaaacgtcattgtggaatgtctaattgaaataagctgacctggttataactgagatccacgtgaatcaaaaacggagaaacgaaaagaagtcgatgaaggttttcaatcaagttgtgagataatttcaaacttttcacggctggaagttgagcaactggagttagagatgagattgaggttcctaaacgtttgtatttttttcgcaatctgacaagcaaatgttgagcagctctccaaatttttcaattgaaaataaacaaagtttcagctcgagcatatattattatgttcttcagaatatgtacagaatatccttgcatgcagatattctgtacagtccgatattttaagcacatacctttgagataaactgttgataaagatttactggtagacaaccattttggtagttcagtaattgaagagttttcaatatgaatatatgtaattgtattgataaatggagatggttgcaaccaaaagtcaaaatccacattcacaagtgacaatactttcaaattctttagatttcgcaaagatccatggaaatt