Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F37F2.3   

sjj_F37F2.3RNAiJA:F37F2.3
PCR_productsjj_F37F2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF37F2.3 Source_evidenceePCR606WS150 Sequence/Annotation Release
Overlaps_Gene F37F2.3 Source_evidenceePCR613WS150 Sequence/Annotation Release
Chunk_score Abs_score550
Max_abs_score550F37F2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI14511591453182
Overlaps_transcriptF37F2.3 Source_evidenceePCR613WS150 Sequence/Annotation Release
WB_DNA_textsjj_F37F2.32024gactggtgttttcataatcgctctcttcttcaaatactctgtcaaattcttccgttcaccaaattgctcgtgaaacttcttgagctgcggagtcctgtctagcgccgtaggagacaaaatcttctgaatatcaagttcctcgaagagcacgtaatccacataactgatattagcgccagctacaaagttctctccattctcgtaggtgcggaagagcttctcaagacgtgcgagatgttctggcaggacatcttgaatgaatggctggcgaccgttttcatagttctggtagatcatggtagcgtaggtggcgtgcaaatcgcggactccctcgtagaacatgtcgatgaatatggtttcttcctcgttggttccgttgagtcctggaatttggtgttttggaatgctaattgttgtgtggtcctttgcgcacaagatgccttatctacagtttaatctacatttgcggcctgtctaccggtatagtgtgacgtaacattcttcccgcttgctctgttgttctccccctctctgtctaggaggtgattgtaaacgagactcttgtatttaccactgctcatattatcgtcactaatattatctacaattttgaggacaaaacaccaatgttaacgagttgctgttgcatttttttttgcagtctaccaagtttgttgtctcactcgtaatagatattttcatagaatttggctacttctcaaaatagatgtaagaacatccataggatgcgttcaaatttcccatttgaaattgaaattctgaaatttccaaaaaaaaaagaagtgcgaaaccacaatttgccgaaaattttcggcaaggtgccgtttttccggcaaattcggcgaaaatgttcaattccggtaatttgccgatagggtgataaaccatgagttttaactttatacattaagccatcaacatctatctgaagagccagcgttcataaagtttcaacggtatcaaaactcgaaatttttaagattctagaattttctcgaattttacagaagtttccggaaggatccagacttttgtcgagttttcaaaagtcagtaactcatttttcccaaatctacagtaatcctatcgtactcctatagtacaactacagtacaactacagtacaactacagtaccccgaccatatccctccattaaccccaaagcaatatctcttcaaaagacgaaaactcaattttttctcaaactacagtaatcctcctacagtactgctacagtacccttactgtacgactacagtaccccgagcatatcccccaccaacatgcaacccaaaatctcttcaaaagtcaaaaactcaatttttcctaaactacagtaatcctcctacagtactattacagtaccccgaccatgtccttccactgatctcccgacccactatatcttcgagtttttggaaaccgtgaatgcacaacagtgcacggcttttagctacgtttaaacatcagaatgtaaagttctagatctaaaaatgggttctcagaagcttcaggtgagtattgcccctcagtgcgtttggacaaatcaaaaattgagaaactctagacatagttagtgctaatttcgctcttaaaatctcgaatacaatacatttacttaccatgaatccttgcgagatgtcttataattgtcccagattgcacaatttccttatcccccatagtcagacaaggacaggagccaaatatctgcaaatttttttcattatgagcagattatcctgttaaactaaccattgtcggtttgatatccgcccattgctcccatgaaaagcgatgatcaatgaatgcgacttcctggtccgtgagaagcatacgaatcggctcaccgataccgcgggttccaaagtaggagaatttaagggtcattttgataagtcactaagagacaatgattgtattttatacccagtgaactgtagacaatacaaacatcgacataatgtttgtgaagagacgcagtgaaatatgatgacaaaa