Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F38A3.1   

sjj_F38A3.1RNAiJA:F38A3.1
PCR_productsjj_F38A3.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF38A3.1 Source_evidenceePCR844WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptF38A3.1 Source_evidenceePCR943WS150 Sequence/Annotation Release
WB_DNA_textsjj_F38A3.11110tcagaacccggtcaattttcattacaaagaagtatgtctcttcgcggctctcggaaattgaaaatggaaaggtccagtgaaaaaaaattgtaaaaaattctagttgaacggtttattcattcgtgtttggctactacatcatcagtcatgagatactccatatcgaaaaaaaaatgaaagacagaaaacggatattttaatatcctggagcagttcttggtggtgggcagtgatcgcaagatccggatgatccagaatctccatcttctccgtcctctcctggacctcctggttgtcctggttgtccgtcatttccggcgtctcctggacctcctggctgtccggcttgtcctggttgtcctggtcttccgtctggtccggatggtcctggctctccttgggatcctggttgtccagctggtcctggggctcctggaacttcgcggctctctcctggctgtcctggctgtccgtcttgtcctggatgtccatcttgtcctggttgtcctgatggtcctggtggtcctggtggtcctggaatagcagctcctccgctttgtcctggtcgtccatcgtttcctggggctccggcctgtcctggagctcctggtggtccagctggagcgtcggcgcattcgaagcagaattctctgttttgttggtgctcgtagctgtcggatccatcttgtcctggggatcctgggtttccagattgtccatcgtttccgtcatttcctggacgtcctggtggtccttgtggtccagcggctccaactccgcatgagcagcactcggcttgacgtcttctgatagcctttctacgggcgacacgtctcttgctcattccacggtgagcctcacgcttgacaacgaatttcgatggaactccggtgaactcttcgacgacttcatattgattgtgaaggctcagagatcggtgcttgcagaagtcaaccttaaaacaaaaacatgtttctttatttcagaagtatcgatttttcagctttacctcggagtcaagcttggactgaacatgttggacgtagctgtagaaggctgggatggcgatgacagcgatgagagcggcggcgatgctggaattgagaggga