Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F38A5.13   

sjj_F38A5.13 RNAi JA:F38A5.13
PF:GL1_3A9
PCR_productsjj_F38A5.13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF38A5.13 Source_evidenceePCR958WS150 Sequence/Annotation Release
Overlaps_Gene F38A5.13 Source_evidenceePCR958WS150 Sequence/Annotation Release
Chunk_score Abs_score874
Max_abs_score874F38A5.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV65858956587003
Overlaps_transcriptF38A5.13 Source_evidenceePCR958WS150 Sequence/Annotation Release
WB_DNA_textsjj_F38A5.131109cagctcgaagcagagcttttgagccagccggaatatgctatgaagtgagtttactatcacctatgtccgcaaatatttcttaactgacattttcagactcgccttattcgagataaactcacactgggccactgtacgcttccaatctataaaaactctcctgttgcaaagcctgttacggaacagcaaagaaaaaagtcgtctgaagagccagctgaattgagaaaagatctttttgatgctgataatgaaaaatatgaaaagtacttgatgaagctggatccaaatgactgcaaaaatcaggatcactacaaagttttaggattgtcgaagctcagatggcaagctacatctgacgaaattcgtttctgttgtaagttaaaatgaagtgagaattttttgaagagaattatttcagatcgtcaaaaggttttgaagcatcacccggacaagaagaagcatcgtggaattgttatggagaaggaagaatactttacttgtatcacaaaagcttatgaacaagttggaatgtctgacgtcaaacgtcaagctttcgattcggtcgatcataaattcaacgatattattccaaatgagaaatcaatcaaccataataacttttataacgaacttgctccagttttccaattaaactccagatggtccaatatcaagccagtgccagaacttggtaaatcagatgcgacccgggaggatgtcgagaatttctacgatttttggtttaacttccagtcatggcgcgagttctcgtatttggacgaagaagacaaggaaagaggagaagatcggtacgaaagacgagagatggagaaacagaataaggcagaaagagaaagacggcggaaagaagaggcgaagagaattagaaagttggttgatatagcttatgctaaggatcctagaattatcaagttcaagaaggaacagcaagcggtaagtctataaactttgcctaaactttgccggattttcaattttaaattttagaaaaaagataaagcaaaggaagataagcaaagagccatccgtgaaaagcaagaagctatcgaccgtgagaagcgtgaaaaggaagaagccgaagctaagca