Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F38B7.7   

sjj_F38B7.7 RNAi JA:F38B7.7
PF:GL1_3A8
PCR_productsjj_F38B7.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH12C20.2a Source_evidenceePCR833WS150 Sequence/Annotation Release
Overlaps_Gene H12C20.2 Source_evidenceePCR895WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1156941711570560
Overlaps_transcriptH12C20.2a Source_evidenceePCR895WS150 Sequence/Annotation Release
WB_DNA_textsjj_F38B7.71144taaaccgggataatttttgtgtgaaatgagatttaaaaatgtaaatagcatgatacagcaagttattcaaattcggctcgatcaggtaaagatgccaagtgacgaattgtgggtcttccatgcggacagttctaaataaaatgcagtttttagactgtgaaaaatataaaataatattacccatggttgatctagcttcgccagatgacgaataatttgtgtcatttcacgttgattcaatggttttccaatcattacggattttctgcatgctttggacgcaaaaattttacgaatacgaactggacggtacatctgattaggatattgtgataccactgccagaatttcttcgagatctgtaaacaggcggaaatttgaaaattttttattgatttaaaactaccactattcgtgagttgttgatttagaagctcgggccttgcagtcaaaaatgttttaatgcatccatcattttcgctgaattcgaaatcgaaaccatttgcgtggaaaatgggcaaattctcacgaatgatcaactcttgtacagctccaaaaccaagcgcagttggcctgaaataatttaaattgaacaaatttcaccagggctttaagctttacatgaaaagtggctgtttagtgagtttagcactgctctgaagacgttcaaaattatatttttcgtcgctggcatgctgatcaacgatgaatagatgaccacgtaggcggcaaatgatgaatccgtggttgaattgaccaatgattttcatttttgaaaaatcgtcttttcttaaaaatataattcaaaaccagaaaaatttttaaatcaattacgtcaatgatctggataattgtctctcggcatcatcattctcttctttattgatttttgttgttatttcattcaatacatccttttcagcagatacttcagcttcttctgtgttatcgtctgtttcatcagttttcggcgagtatgcttcacggagcaacttcatagagaattttatctaaacaagatatggctttaaatccggtggatcttttttcgagcagaatcaggaacttactttctgttgaggtcgcagcgtaaaatatgatactctagaattttgagaagtttgagaatcctgtgaacattgtg