Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F38E11.5   

sjj_F38E11.5 RNAi JA:F38E11.5
Simmer:F38E11.5
PCR_productsjj_F38E11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF38E11.5 Source_evidenceePCR887WS150 Sequence/Annotation Release
Overlaps_Gene F38E11.5 Source_evidenceePCR887WS150 Sequence/Annotation Release
Chunk_score Abs_score824
Max_abs_score824F38E11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV94616229462610
Overlaps_transcriptF38E11.5 Source_evidenceePCR887WS150 Sequence/Annotation Release
WB_DNA_textsjj_F38E11.5989cggggactgctttattttcaccactgcactcaatagaatcaactattatgtcggtggagaaattgtcactattgctcatgttgatagaccactttatttggtgagattttaaaacatgcgttgttcttatcatttttaaaacttaaatattttagttgggatacatggctaaggaatctcgagtctatgccgtcgataaggatctcaacgtgatctcatacaaacttcttctatctgttcttgaatatcaaactgctgtaatgcgccgtgacttcgatactgctgacaaggtacttactacaattccaaaagagcagagaactcgtgttgctcatttcctcgaaaagcaaggattcaagaagcaggctcttgcggtctctcaagaccctgatcacaagtaagacaattttcagcttttcagcaataattttggaacgttttcagattcgatctctcggtagctcttggagatttgaagactgcctacgatttggcactgcaaagcgattcagaagagaaatggaaggctctcagcaacgccgccactcttaagtcggaacttcttcttgctggtgaatgtcttggaagagctcgcgatttcggaggtctaatgcttcttgcaacgtgtgccggatcagctcctcttcttcagaaacttgcggatgactctgctgctgccgaaagccacaatatcagcttcctcagtagtttgcttcttggagatattgatgcttgtctagacaaacttatttcgactggtcgcctcccagaagcagcgttccttgctcgaacacatgcgccgtctcgagtttcatctattcttgaattgtggaaagccaaggcttcgggacacagcgaaaagagtagcagaaagattggagaatctcttgccgatccagtgaagtatgaaaacttgttccctggatttacccaatcactgaaagcagaatctttcgttcgtgagatctccaagattccagtcccagcat