Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39B2.10   

sjj_F39B2.10RNAiJA:F39B2.10
PCR_productsjj_F39B2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F39B2.10 Source_evidenceePCR968WS150 Sequence/Annotation Release
Chunk_score Abs_score906
Max_abs_score906F39B2.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1475714314758213
Overlaps_transcript (3)
WB_DNA_textsjj_F39B2.101071taaaatggcgctcaaattccatccagacaagaatccagacggagctgagcaattcaagcagatctcccaggtttgttacgaaatccagctgcaaagttgaaattactcatattgcaggcatacgaagtattatcagatgagaagaaacgtcagatttatgatcagggtggagaagaagcacttcaaggcggtggtggtggcggagagggattccacaatccgttcgacgtattcgacatgttcttcggaggcggtggtcgtggtggtcgtggagaacgtcgagtaaaaccaacggttcacaatttacgggtcacactcgacacactgtacaagggtgttacgaaaaagctgaaaatctcaagaactgccacttgtaaaggatgcaagggacttggaggcaacgagggatccgctaaggagtgctctgattgtcgtggacgtggaatcaaggttcgtgttatcagaatgggaccaatggttcaacaaatgcaatctcactgcgacagttgtaatggagaaggctcaacattccttgaaaaagatcgctgcaaaaagtgtaacggaaagaagcaggtttgacttttctccaatcgaattcgaaactataattagtgatttcaggtgaaagaagacgaaattattgaagttggaatcacgcctggcatgaaagatggcgagaagtttgtgttcgaaggaaaaggagacgaagtgatcggtattgagaagcctggagactttgtagttgtgctcgacgaggttgaacacgagaaattcgtccgaaaaggcgataatctgattattcaacacaatatcgatctttccgaggctctgtgcggatttgtgcgaacaatcagtacacttgatggtcgaacaattttctatcgtgttcttcctggagaggttattgctcatgccgatgttaaagtgatccacaacgagggaatgccaatgcgtcgagcatcatctgataaaggagatcttctcgtacagttcgatgtgaaattccccgataaaattaatccagatgccgcgaagaagctagccgatttactgcctggaaagagttcgttt