Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39B2.11   

sjj_F39B2.11 RNAi JA:F39B2.11
PF:GL1_5H2
PCR_productsjj_F39B2.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39B2.11 Source_evidenceePCR933WS150 Sequence/Annotation Release
Overlaps_Gene F39B2.11 Source_evidenceePCR1013WS150 Sequence/Annotation Release
Chunk_score Abs_score950
Max_abs_score950F39B2.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1475524514756354
Overlaps_transcriptF39B2.11 Source_evidenceePCR1013WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39B2.111110gattttgtcgtctcgtgggtggcagtaggtagggggcaagcaaaaaaagaagaacaatttaaaaagaaatacaacaattttcactcagagatctcctcttcgactgacacttgaatcagaccggtatgaattgcgaacactaatgacaacgtgagagctccgagagtgaagagaatcgcatcccgcattggaggctcttctggaagtgattccgacgcttcttctgttgttttcgcggcttctttgtctgcttttgctttcgagatccgagattgccacattttccgattcgcttgttgtcttttgagctcatcttcgccaagtggcaggtagattgatgacacagtttccacgaatctcactaaattcggacatgctgagagctggacttgaagacgatcatttggcagtggaactcggagcagtggagcaaggtagccgaataccagggcatccagtgacgtcggcttatttccacagaaaaatttattatcgccaagctttgtggatagagtattcaacgccatgaatgcttctttcaaaatttcagtgtcattctttccagccaacaatcgcaatgccttctttcgtcgcttttcgaggtaatacagattgtaggggaaatgcagatgagatgcgtaccaatattgcgtcactgtattgtaattgagctcgtccgtccaaaatgtgtgcatctggaagggaaaattgatttatttcagcttaatttttctttaatcttaccactgctggatacaaattgtgatgtaaataacaggaaaatgcgtccaactgtgctttctcaatagtggtcaagtctgcatcgataaccacgtcttggccgcactttttcagaatatccacaaatttttcgaaatctgtcactggttttgcttctccttcggtttgagcgaccattgggagctcaccgctcggcgatctccaaggacgggtcgattggatgactcttactgggctggcacacattttagagcacgcctggaacagaaatgacgataattaaccaaagttgacacaaaatcttaccaaaaactgcagagacacaacgtcaatagttgggagaccgaagtctgacggccaaatgtgtaa