Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39B2.3   

sjj_F39B2.3RNAiJA:F39B2.3
PCR_productsjj_F39B2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39B2.3 Source_evidenceePCR838WS150 Sequence/Annotation Release
Overlaps_Gene F39B2.3 Source_evidenceePCR838WS150 Sequence/Annotation Release
Chunk_score Abs_score775
Max_abs_score775F39B2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1478826414789379
Overlaps_transcriptF39B2.3 Source_evidenceePCR838WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39B2.31116gagccagtcctaattgctcgagacgatacaatttgtttataagtggacgaaactcggtttccttcaagaatgagacaatgttgatgccaaagtccaagagctcagcctcggaagacattcccaatgctacaccgtaaacagctccttctgtaaccataagttgtcttgcgttgatcgtggtctcggcgcgatttccaattactgcaactctaccacgtggagccagcaatccgaggtccgtgttcagatttgtgtgagcagccatttcgaaaatgtggttgaagcctcctggataatcatttttcattttcgacacatattgcttatccgaatgattatagacattccgtgcaccaagactcttcacgaaccggatcccatcagcagatccagcagtgccaacagcttcaatgttcctccaggcagccagctgcatcagtgcacttcccactccaccagatgctccgtgtacaagtataacgtcgccagtctgagaagagaattagttttgggagggaacagcagatggtcgtattttagaccgccccttgtttgagatggaacagatggtcaagttggctttgtaaagattgatttgtattgattttgcctcctaattttgatacgtttttgccaaaattttaatattctctatgaaccatttaataataaataaaagtcaaacctttgcaccagcaagatgaaacaatgcacgataagcggtaagataaggcactccgagagaagctccttcctcaaacgaaactcctgaaatgagattttagctatatcttaggtctcgccacgcgggcaactagctacagtaacccgttgcgcaatgattcttttaccttccggcaactcgaatggtcgattcaccgcaacatactctgctgtactgtccgcttctgatccataccagactcgatcgccgactttcacatttttaacgctttctcccacaagttcgacgaatccggctccatcttttcctggtacatatggaagatttggtagttttccatactgaccagcacgaatatatgtgtcaactggattgacaccggcagcgtaattccgaacgagaacctggtttttttcaagcctgggcatatc