Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39B2.7   

sjj_F39B2.7RNAiJA:F39B2.7
PCR_productsjj_F39B2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39B2.7 Source_evidenceePCR744WS150 Sequence/Annotation Release
Overlaps_Gene F39B2.7 Source_evidenceePCR748WS150 Sequence/Annotation Release
Chunk_score Abs_score685
Max_abs_score685F39B2.7
Specificity_index0.846
Rel_score1
Map_statusUnique_ePCRI1477058614772630
Y49F6C.6 Chunk_score Abs_score125
Specificity_index0.154
Rel_score0.182
Overlaps_transcriptF39B2.7 Source_evidenceePCR748WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39B2.72045atcaaaaggtgaaaacgggtaattcatacacgctgaattcagaaaatctaggtttaacccaaaaaaaaactatttaaaagtgccaaaaatggtcaaagcttttattttccgatacaaaatttgctaaaaattccatctagaacactttcagtgacaattccctcggtgagctctccgatttgttccaaggcaacttccagatgtgaacacatgattgctgcgtcgttacacgttacagctgactccaattcgaatgagcatcttctgaaattaaaacaactttgaatattattttttgacaaaaaaaaaccttaacagatctgcatctagtaaataacttgcttcaggacacagatcatctacaatttctcccaaacagttttgaagttgtttgcagccagtatctgtggtagcatttgtagatacagtagtgaaatttgagggaagttttggatacttcagactcagatcagacttattctttgcaataatcacacgagcttcgcgatttcgcatcacttccacgtcattcaaaatcgattcaacatcgtcatccgacgtgaattgtggatccacgacaacgcagataatgtcagctgattggattcgtttttgagcacgtcgaataccttctgcctcaatgacgtcattagttttttgtcgaactccagcagtgtctgtgagacggcatcgaactccgttaatttgaatgattgtctgtaagattttcaattaatgtttggaacattttccaggcactctaggagtactgtaggattaccgtagttttcgaaaaattgacttttcgtcttttgagctacaaaattgcccgttttagagaagattcaaaattgtgaatttttgctataaattggccatttttgccactttttaatagtttttgacgggttaaacctagattttctgaattcaacatacataaattacccgttttcaacaaatttagacaactttttatttttgcccaaattattttcagccatctaatgactgtcctttttttttattttgggcaaaaaaataatttttctgaaaatgtttaaaactactatattctgaaaaaggtcaatttttttataatcctaaatcaattttgagtcctctagctacaaaattgcccattttagagaagattcaaaattgtgaatttttgccataaatctgccatttttgccactttttaaaagtttttgacgggttaaacctagattttctgaattcaacatacataaattacccgttttcaacaaatttagacaactttttatttttgcccaaactattttcagccatctaatgactatcctttttttattttgggcaaaaaaataatttccctaaaaatgttcaaaactattatattcttaaaaaggaaaatttttttaatgtttgcagatcaattttgagtcctctagctacaaaattgcccattttagaagagtttcaaaattgtgaatttttacaaaaaattggaatttttgccactttttaaatttcaaaattgtgtgttttagaggagtttcaaaattgattgttcaagggaacgtggctagggtactgtagtagtactgtagggaatactgtaggattactgtagggttactgtagttggagaaaaactggtttttcgtattttgaagggttattagtttggtgttaatagggggatatgattggagtactgtagtagtattgtagggaatactgtaggattactgtagttttggaaaaactgattttagtttcagaaaaaaaaatcgcaaaagaaaatttgattgaaattttttggttaatttttgaaaaatttgaaaaattttaacacttcaataggtttatatgatcatttttacttccaaactatctctcgtggttccaggaatcgagctaacaattgccacgtcatcatgcgctaactgatttaaaatgcttgattttccggaattcggtcttccatagagcacaatatccaatccacgttgagcccgttctgcaccatcccacgctttgatcattcgattgagttc