Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39B2.9   

sjj_F39B2.9RNAiJA:F39B2.9
PCR_productsjj_F39B2.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F39B2.10 Source_evidenceePCR132WS150 Sequence/Annotation Release
Chunk_score Abs_score111
Max_abs_score111F39B2.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1475864014759705
Overlaps_transcriptF39B2.10.1 Source_evidenceePCR132WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39B2.91066gtttcgtcccctcttcattactttttttgtttgatatcgatatcctacccacattcatttcagtgttacgttttcccttaattgactgtccgtcagtcttttgtgaacaagggagaataaaaaaattgatttatttttgccattcctttcgcctaaatccgccgatcgatgcgctcacggcaagaacgcacggtggaagggaaagaaaagcgaaaagtagccaaaaatgtgcaggtggatgcgaatcgtagatgaaaattagaaagaaaatgctggcaatcgtgtgtgacaacgtggaatatagagatcgagacggcgacgggagatccacgagaattgaggcgaattcgatgagaatagcgagttttgtgaagaccaggcaaactgtgaagcctattcgggcctcctcactgatggatgcaccgcccgaaactgatgcttccaaatgagaagccttgaaaaatagattttagattttaaataatttttttcgagacttcctaacctgagaaaatattgtaatcgtcgacaaggcgaaatgtcccatcaaacattgaaagtatttagtacaggtgtccgttttcgtgaacatttcttaaagaagcttgcgaaaatcgatgagttactccactagcccacttctcccgttgccatggcgacgttccttctttcaattacattttcgagtgctttttcgctgtagaccctataggtttacatgaaaaattttattttctattcattttccaaaaaaaaaaccctgaaaatccctttttttccttctttttctgtgaaaaaatagatttcaatttctcgaaacgcgagaaatggcctagaaaaccccatagcggcggccatggccggtgtccggcagcgttgagttagatgtgcaggtatcgtaacccagtgtgcatttaacgtttctccatcgtatttcgctcacttttctgctggcctaaacgattttttgacttttttcttgaaaattcatcgttttttctgaaatttctgtttaaaaaaattgaattgacaaatataatcgatttagttcatgttttcgccagat