Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39G3.7   

sjj_F39G3.7 RNAi JA:F39G3.7
Simmer:F39G3.7:Repeat_a
Simmer:F39G3.7:Screen
PCR_productsjj_F39G3.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39G3.7 Source_evidenceePCR791WS150 Sequence/Annotation Release
Overlaps_Gene F39G3.7 Source_evidenceePCR791WS150 Sequence/Annotation Release
Chunk_score Abs_score728
Max_abs_score728F39G3.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV47153794716556
Overlaps_transcriptF39G3.7 Source_evidenceePCR791WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39G3.71178tggagaatagttgtgcaccggacattttttcgtcaactttacttgcctgaaaatgcaaagtttatttttagttgaaaaaaattttctaacgcttcaaaaaaaagaactcacaatttctctcaaatcaacatcctcttcgaatctcatttttcttgagactgcttccaaaatcttagtcttcgactctacatcttcaccaggcttcacctcaaccagcttatcaaatcttccaggagtcattagagaattatccagcaaatctggacgattcgtagctcccattacaaaaactttagttagtggggagttatgaagtttgtctagctccgcgagcagttgagatacaattctgtcaatgacccctccagaatctccattccttccgcgattcggagccaaactgtcgatttcgtcaaagaaaattacgcacggagaagcttgtttagctctttcgaagactttccgcaggttctcttcactttgtcccacgtatttattgagaagttctggacctttaactgataagaatgcaattttaaactccgttgccactgccttagcaatgagagtttttccgcaaccaggggagccataaagtataattccagatcttttaagagctcttgagccaaataaatttgtgcggatactttccaggacggtctgtttcgtctcttcgagacctccaacatcttcccatcgtacatttggaatctgcaatgaaaatgtgcaatttgaaaataaatttagattttttcaaagttaaaattaactctgaatttttttttcataaatttaacatatttttttctggaaattaaataaaagcaaagtatcgtctgtgagtatttgttcaaattgccagaaaccagtctccgagagtgattttccaaattcttttcaattatttttttcaattttgcaaataaaaatactgaattatttttgaaaacaaatttttaaaaattccatagattttctaaacaacaatattctttttgataaaaagcactactcccatagaaaaaatgctcacctttggtgctccaatagcatctgcaaaattcgaattcctcttatcaatcaaatcctcataaactttctcttccttctcctcgattttcactttcttcccatttttcacgagcttttccaactctgccaacgtaaacccagat