Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39H11.1   

sjj_F39H11.1 RNAi JA:F39H11.1
PF:GL1_5H3
PCR_productsjj_F39H11.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF39H11.1 Source_evidenceePCR675WS150 Sequence/Annotation Release
Overlaps_Gene F39H11.1 Source_evidenceePCR714WS150 Sequence/Annotation Release
Chunk_score Abs_score609
Max_abs_score609F39H11.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86964158697554
F39H11.2 Source_evidenceePCR36WS150 Sequence/Annotation Release
Overlaps_transcript F39H11.1 Source_evidenceePCR714WS150 Sequence/Annotation Release
F39H11.2 Source_evidenceePCR36WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39H11.11140tttacactgaataccacgcacaattgcgtacttcaataagaaaaattatctcgcgctactttttttgagataatattataatataaattaattcatattttataaatatattaattcatattttattcttttgaattctcactgaaattgtgaaactatttaaaatataaattgtttcagaaaaatgacctcggagcttaaaaataacgaagaagactacaactcatcgtccgatgaagattacgatccaacaaaggataccgattttgatccaaaggatgaagtaagcattcctagatatcgcccttttattgctcattctcctcaacagatcgatgatcaagaagaatgcgaagatggaattgacgaagaagttgaacatctgaaaaatgaaaaacaaagtgacgaccatacatcagaaaaggcaaacagtactgaaggaagtgttgatgtggatgcgatatttgcagaattaactgggctagcaccgaaaccagttgtcaacgatacatcaagcaagaatattccaaaaactgaagaaagggtgtatccaaaatcagcagcgtatgtttgaaacaagtagaaataacttttaaaaatgtattttacagatctgcatccaacgagtctacaaatcagaaggtttatccgaaaaagtgagttgacatgagtttttatttgatacaaatttaaaaacaactttttcttatttttctaataatttttttcagaacggaaacagctggaacatcgtctgaaagtagcattgtacccggaaagaaaagagtcggcttgcttgatgctgcaaaatcactgtcgaagcgttctaaaatttctgttttggagaaatctgatcgagattggaaagattttacgacgcaaaataatttaaaagtatgtttctttaagtttaaggtttttgaataaattgtttgtttttcaggaagatttggaatctcataaccgagggaaaggcggttatctgaacaaaatggacttcttaaaccgagctgataatcgccagtttgaaaaagaacgagcgttccgtgcaacagctcgtaaggacactggacagtaaataattctttattttttcaattgaatcttttttgtgattttctggtttctttgacaattcgt