Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39H11.5   

sjj_F39H11.5 RNAi JA:F39H11.5
Simmer:F39H11.5:Screen_A
Simmer:F39H11.5:Screen_B
PCR_productsjj_F39H11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F39H11.5 Source_evidenceePCR762WS150 Sequence/Annotation Release
Chunk_score Abs_score657
Max_abs_score657F39H11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86953138696363
Overlaps_transcript F39H11.5.2 Source_evidenceePCR711WS150 Sequence/Annotation Release
F39H11.5.1 Source_evidenceePCR762WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39H11.51051aacatggagatactgaaacgcatcctgcacaccggggaaaacttattcatattgacagttagtctcggcaatcgaccagtcaccaataatcttctcttctttacccaaaacgacaccttctgtcgcatcaacacgtccgatttcgaactcattgtcagcgacgcagtcgtggtagagagtaagttcaagcgatttgcgaagcacggcttctgcctcttcacgggagaggtcttctcccttctttctccactcatcttcaacagcttggttgaggaggaacgctccaagtccagttgcaatgtgcttcacttgatatgcgcatccctgaaatttagaataattattatgtgattatttaatcatgagattctgatccggcaagttaacgctttcaagtttaccttctgagtaatgacaccgatgaaaggtgtgctagtctccttgttgttcttctcctcctcttcgactccggcgacaacaagtgtgttccacactgggttcatcttgcaacgtctgaaattttttacttaaactttcaatttaattaggaaaacagacttggcgtagagaaggcttgtgaggtatccgtggagagcttttggtccaatatcctgatcgaagcgcttccagagaagaacctgacgctcgatcacattttgaagccagtggaagtcagcgtgatctcctccgaaggcaatgagaacattatcattgaccttgtattgacgagaaacattctggaaacaaatattatgaaaatccactttcagctgaacggaaattcaaaccttgtaacgagccatttttccataggaaacaactcgatcagtaaggacaacaaccccagttttatactggagagcgataaccgatgttccggtacaagtaggattcctgaaaaattgagttaattcaaacgaatataggtttaatgacttacagtgtgcgctggacttcgtcgtgagcattcattttggttctgaaacaatataaatgaagtttttgaagggagtgctttgaaaaaatgaaaggaagtgaatttcgacaatga