Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F39H2.1   

sjj_F39H2.1 RNAi JA:F39H2.1
PF:GL1_3A7
PCR_productsjj_F39H2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F39H2.5 Source_evidenceePCR995WS150 Sequence/Annotation Release
Chunk_score Abs_score890
Max_abs_score890F39H2.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86611138662310
Overlaps_transcript F39H2.5.2 Source_evidenceePCR995WS150 Sequence/Annotation Release
F39H2.5.1 Source_evidenceePCR995WS150 Sequence/Annotation Release
WB_DNA_textsjj_F39H2.11198attgttcctccagatccacgcattggaaaagccgttgaagaaagtggaaaagaatttctaattgaaattgatgtttacgatgatcatcgaattggaatagagaaactcaacgtaatgttttttcattcaatctctatattttaaccaaaactctcttgcagtctggtgattttgtagccctacaaaatgtgcatgcagcgtccgtggggctgaccgaaatgcaagttcttcacggtggtggacaagcatataatcgcggaatttcgaaagttccagtcgatttcagaaatgaagcctttcagatattcaagaaaagggtcgaatctgtactggaagctgttactgactgtgataacttcatagagttccaacagaaagaaaacgtagtccaatctgaaacatctacacagacaagttcttcgaatacatcaggagatgcagatttaaaacattgccaacaaatcaaaattggagaagatatttctgtggattattttttgtaagtccggctgcatcgaaaaggttaaaaattatatctatactttcaggaaaaagtccggttctcggtacaatttcttgacgcatgctcattctgatcattatcgtggtcttgacaagaaatggacgcggtctgtgtactgtagtccagaaactgcaaaacttttgccacatatcatggggtgattgaatcattaaagtttaaggctcaaaaatattttccttattcaggtacaccgccgattctccacccccagccggtctaattaaccctcttgaggagaacgtccctcacaaatttgatagttttcaagtgacactagtcaatgcgaatcactgtcctggagcagttatgtttgtattcgaaggatcaaaaattgaagaaatcgcaggcggtgctgttctgtgcactggtgattttcgagcagataaaatgtttttggaaagtctaaaaccaggaaaccaattgcattggatgaccgaaataaaatttggaattatttatttggataacacctatttttcattggatatgccgtttcctgaacgatgcgaggcagaaaaaatgtaagaaatctaataattcgctattatttaaattttaatcagtttaattttttagactcctgaaggctattgaagcacatccgcatgaaaatattgttattcccttgcatagacttgggcgtgaagaattgat