Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F40F8.10   

sjj_F40F8.10 RNAi JA:F40F8.10
Simmer:F40F8.10
PCR_productsjj_F40F8.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F40F8.10 Source_evidenceePCR641WS150 Sequence/Annotation Release
Chunk_score Abs_score599
Max_abs_score599F40F8.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1112532011126434
Overlaps_transcript F40F8.10.1 Source_evidenceePCR641WS150 Sequence/Annotation Release
F40F8.10.2 Source_evidenceePCR596WS150 Sequence/Annotation Release
F40F8.10.3 Source_evidenceePCR605WS150 Sequence/Annotation Release
WB_DNA_textsjj_F40F8.101115aaacgaatcactggaagacgttatgtccaacaattttatttgtaaccaaaacaaatttattcctcgtcgtcgcctccggctccatctccctttctcaaggtgcgtcgcttgacgcgtcctggacggccacctccgtatggagattgaagagagaagtcgatgtgcttctgggagtccaaacgaacgatgaaggatgggacatcgacaacttgtctgcggacactgaaagagaagaatttgaagtcgatactaatcttgtaatttgtcatgtcatctttcagtgaaataaattttttaatgaaatattccggacaatgactactggatcagtcttcaaaatagcgcaggaatacctaactggtttaaatcgaaaaacatttgtaaaaaattaactgccagaacaatcaattttccgaaagatgaatttaatgttaaaatgatagttctaaaaactgtttcatttttaaatatatttttatacagaaacaaaaactaaccggatgtggtgctgcttgatcaagatacgggcgtggtggatagacttggcaagtccgagcttgaagacctgggtttggagcctgcgctcaaggaagtcctcgaccttaagaccgagaacgtaatcgagcttcatcttggtctcgtcgaggacaccgatcttgacaagacgacggagaagggcatttccttcgaaaagacgctttggatccttgtcttcaagagtaagaagctcacgagccgccttacggaccttggcgagggtgtacttgacacgccagacctcacgcttgttcttgagtccgaaagttccgatgagcttgagctcctgtaaaacaaaattttaaaatataaattttactttgacatttcaaacctggtcaaggcgctccttctcgaacggacggcgtggcgactttgtcactttagattgcacagtcttcagacgtgccatagttgaaccctgaaaaaaataaatagaaaattgaagtttgaggcagcaacaacgaaaacagagggaagcaaattacaaattaacgataaaaataacaataatgtaatgaaaattcatttttttaattaattttctgacaatttcattcaaaaattcagcgattttc