Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_F40F8.7_f   

sjj_F40F8.7_fSequenceGGCAGACAACCATACCTCGT
Length20
In_sequenceSUPERLINK_CB_II
PCR_productsjj_F40F8.7