Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F40F9.6   

sjj_F40F9.6RNAiPF:GL1_5H5
PCR_productsjj_F40F9.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF40F9.6a Source_evidenceePCR729WS150 Sequence/Annotation Release
Overlaps_Gene F40F9.6 Source_evidenceePCR729WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV97312679732338
Overlaps_transcript F40F9.6b.2 Source_evidenceePCR689WS150 Sequence/Annotation Release
F40F9.6b.1 Source_evidenceePCR689WS150 Sequence/Annotation Release
F40F9.6a Source_evidenceePCR729WS150 Sequence/Annotation Release
WB_DNA_textsjj_F40F9.61072tgtattgcgaagagcaaacgcgtcagcgtgttctggaagaccataggcagttttgaaattgacaaatgaaatgtcgactccgacgctgcttgagccgtgttgcttgtgatcagtgaatcctttgaatcgttcctcccagaatccttctggatactctttgccctcttcttttgtgcggaactcttctacctgaaaatgagagatttattgtacgattctggttttatttcgaaaaccttgagttttccatccctattaagttgagcaacgagctcatcaaattcgttaaaaatgctgacgaggaatggtttataggtgactacaactttcaattttttatttcctccaataatcttagcctcttgatctccattctcgacactagaaaattctagttcttctggaagagaaaccaatgctggattcggaacataacgctttcggattgcactttcaggctcatcaatctggacacgcactgttgaatcctataatttggggattcattagttttgttggatttttcggaaactcactgccaatcctataacattgatcttgagtgtgttctgggaattgcgaacattggccgtccaaactgcgccgtggtgtgtgatggagtcagcaagaagttcatagccagttggctcctgaagactccagttatgatggttttgagacccacgcctcactgttatagctctatgctgtttgcaaaatgcactctgctcgcaagttttaaaatcgtctcgtttgaccatctgaacggccagcggagtggccagaagaatgattgggacgatccaactgctcccggcggtcattactggaatcgaaggtttgtaaactttttctcaaaatgcctaatacgtctcagttatttatgaattcaatcagttcttgatgaaataattatgtgacaaggaaagaaaaccaataatcttaacaaaataaattatatttagtggttggggaaagagatgtacatagaaagtaattatttagcaaatttacccaaacaatttctaaaatccgcgtaaaaatgttttgaatcgcctcgagactcaaaaat