Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F40F9.9   

sjj_F40F9.9RNAiJA:F40F9.9
PCR_productsjj_F40F9.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF40F9.9 Source_evidenceePCR731WS150 Sequence/Annotation Release
Overlaps_Gene F40F9.9 Source_evidenceePCR731WS150 Sequence/Annotation Release
Chunk_score Abs_score626
Max_abs_score626F40F9.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV97404659742093
Overlaps_transcriptF40F9.9 Source_evidenceePCR731WS150 Sequence/Annotation Release
WB_DNA_textsjj_F40F9.91629ttctgccatttgaaagtgtttttcaagggtatgccacaaaaactgtactctaagctgctaacattccgatcaaacgttttgtaacagtctctagcatatacaaaattttactaaattctctttcaaaagttataacgtaaatacaaagtttgagttgtaaggagtaagatcacaacaggaagtatcgaaaatttgtaaattattatgctaagtttaaaaaaattataactaggtattgtgagactgcaacaataagttttcaggaagaaacatggggtcagccagcaactacaaatcgtaaatcttcttacacatcaagaaagaaggaatattcattgctgacaaaatgtgttgcagagtttctcggggaccttacatttgtatatgtcggtaagctgctgtgcttttaaaaaataccttttgaatcgaaacattacatttttccaggtacaatgcaagcaagtttattccaatatgccgatggaattcttcacgcagcctttgcacacggattcactattttcattcttgtcactgccttcggtcatatcaggtacaattgggaggtgatgaaaactttggaataatagcacattgatagtagcgatgcttatcaaacagaattaggctccttttacagtcacacgtatgggaataaaaacgagttttccgcgttggcgaaacaatttgcacgcactagaaagcacgaagtttatgaattagcgaagatggcaagactataatttttcagcaaaacaaacagtaaataatcatttaaaatagaagagaacattgtaaattatacattttgtcattgaatttgtcatacgaaaattcccggcatcaatatagtgtagtttttaagaaaaggatcccatggaaaaaatagagatttccgtgtctgaatggcgaaaaagcgatagcaactatgaattagacaatttaaattttaagaatgtttccaaattacagtggtggtcatttcaaccctgcagtgtcatgggcgatcgctggagctggaaagatgccaattttccaccttccattttacgtcgtatctcaacttctcggaggaatctgtggagcatttctgacagcagcagttttatcccaagaacagctaacaagttgcgaagccggagcaacattactttctccaggcagtcaatggtggcagggattaattgctgaaactgtggttactttcttcttggttcacactattctgatcactgcagctgatactgatacagtgagttcactgaacataaatttgtacaagttacatttttaggtaacattagcccctctggcaattggtctcacgctgtcgattgatattctttcaacgtaagtattgaaaatattgctaatatacgatgcctcataaattaaatgtttcagtggatccatcaccggcgcctcgatgaacccagctcgatcactgggtccaagcattattggttcgatttttgcaactcaaaaaacatctttttactggaataatcattatatatattgggctggaccacttcttggatccacaatagctctttgcatttacaagtaagtgaagaatagcaaattgaggtccaagtgggacgagtctcgtttccgttaaatggttaa