Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F41D3.5   

sjj_F41D3.5RNAiJA:F41D3.5
PCR_productsjj_F41D3.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F41D3.5 Source_evidenceePCR807WS150 Sequence/Annotation Release
F41D3.10 Source_evidenceePCR807WS150 Sequence/Annotation Release
Overlaps_Gene F41D3.5 Source_evidenceePCR807WS150 Sequence/Annotation Release
Chunk_score Abs_score680
Specificity_index0.5
Rel_score0.999
Map_statusBest_ePCRI1226182412262912
F41D3.10 Source_evidenceePCR807WS150 Sequence/Annotation Release
Chunk_score Abs_score681
Max_abs_score681F41D3.10
Specificity_index0.5
Rel_score1
Map_statusBest_ePCRI1227116612272254
Overlaps_transcript F41D3.5 Source_evidenceePCR807WS150 Sequence/Annotation Release
F41D3.10 Source_evidenceePCR807WS150 Sequence/Annotation Release
WB_DNA_text sjj_F41D3.5_11089cgtgctcagtgtgtagggaagagcattgatgaatattatactgaacaatgggagatatgacacataatttactgaatgcgatttttcggcatccgggatattttcctctttgtcgactataagtttgtattcttcgacgtctccctcgacttctgatctattcagaattccaagttggaacactatcattcctgaaattgtagtagagtcaataacaaaaagcttgagaaaaagctgaaaacttgccaatcagaaattgccagatcctagcaaaaacgctgttgaaagaagtattgtcaggtgtgaaacagaaaaatgcatatgagcacagtcctggattacttcaggtaacaactttctaagattcggggaacaattcttacctagaatggcataatacgcaagctgaagcttggcagaaagccttgtcgcaataagaaatataaacggaacaagacaataaaactgagcctccacggacaacgaccaggtatgagtgaaaatgtcgatagctttggttagctgaagtttttcaattttatcaaaaatttcttagaacctatgaattaccattgaaaaatagttatcttgcgctgaagttggagcatttgacacaaagagcatcgcacgggtggcagatttttggttggtttctatagaggtgtctgggaagattgtgtagagggagatcatggagagcaggatgatgagtaggtaaagcggaaggattctcttgaaccttttcgagtagaacaaggtgattagagtacaagttgaatcactttcagctcgcttcagtagcatgcacataaggaagccggataggacaaagaatctgtaaaatttcaaagtggaaataaacaaaataaaaaagaaaagtgcacatactgatcaactccaagatatccattgggaaactgtgcaggatagaaatgaaaaccgagtactgccaagatggcaagacctcggagcccttgcaaatccaatcgctttggtttagatgcttccgacatgaatagccgtgaacagcttaggtgaatagcaagcctctaaagaccaaatggtgtggcgatgaggagtcgggataaa
sjj_F41D3.5_21089cgtgctcagtgtgtagggaagagcattgatgaatattatactgaacaatgggagatatgacacataatttactgaatgcgatttttcggcatccgggatattttcctctttgtcgactataagtttgtattcttcgacgtctccctcgacttctgatctattcagaattccaagttggaacactatcattcctgaaattgtagtagagtcaataacaaaaagcttgagaaaaagctgaaaacttgccaatcagaaattgccagatcctagcaaaaacgctgttgaaagaagtattgtcaggtgtgaaacagaaaaatgcatatgagcacagtcctggattacttcaggtaacaactttctaagattcggggaacaattcttacctagaatggcataatacgcaagctgaagcttggcagaaagccttgtcgcaataagaaatataaacggaacaagacaataaaactgagcctccacggacaacgaccaggtatgagtgaaaatgtcgatagctttggttagctgaagtttttcaattttatcaaaaatttcttagaacctatgaattaccattgaaaaatagttatcttgcgctgaagttggagcatttgacacaaagagcatcgcacgggtggcagatttttggttggtttctatagaggtgtctggaaagattgtgtagagggagatcatggagagcaggatgatgagtaggtaaagcggaaggattctcttgaaccttttcgagtagaacaaggtgattagagtacaagttgaatcactttcagctcgcttcagtagcatgcacataaggaagccggataggacaaagaatctgtaaaatttcaaagtggaaataaacaaaataaaaaagaaaagtgcacatactgatcaactccaagatatccattgggaaactgtgcaggatagaaatgaaaaccgagtactgccaagatggcaagacctcggagcccttgcaaatccaatcgctttggtttagatgcttccgacatgaatagccgtgaacagcttaggtgaatagcaagcctctaaagaccaaatggtgtggcgatgaggagtcgggataaa