Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F43C1.3   

sjj_F43C1.3 RNAi JA:F43C1.3
Simmer:F43C1.3
PCR_productsjj_F43C1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43C1.3 Source_evidenceePCR345WS150 Sequence/Annotation Release
Overlaps_Gene F43C1.3 Source_evidenceePCR435WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusBest_ePCRIII42429404244133
F43C1.6 Source_evidenceePCR389WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusTop85_percentile_ePCRIII42429404244133
Overlaps_transcript F43C1.3 Source_evidenceePCR435WS150 Sequence/Annotation Release
F43C1.6.2 Source_evidenceePCR387WS150 Sequence/Annotation Release
F43C1.6.1 Source_evidenceePCR389WS150 Sequence/Annotation Release
WB_DNA_textsjj_F43C1.31194tttctcaacaacaacagcgtctacagtaaccgcagatgcgtcaagaagtggacgtccgaagagtgagaagttcgtgccaccgaccatcaaaactttttccaattttatttcatcaccaacgttcaatgggagatttccctccatattgattaaatcgccatcactgacctgaaagattttggggttttcgaaaaatcgatttaaaaaaaaactaattttcatattttgcaaatgttcttcagaaaaatttggattttatggttattgatattttccaaaaagtatctatcctcaatatgtatatgtttgcaagttagtttgctccgaaattgaattcagtttatcgttttttggtccaaaatttcgtttttaccttccattgtcttccattaacatatacaactgcaaacaatcgttgcctcttctcctcattaacttcatccgagattgacttgaatacttccttctgaacttgctctgtatcgattacctgagcctccgatgacgtgccaactgatgcagattgaatggaacgacgaagaattgattgggatgaggagaggagaagtgatgcacagcgactggagagcatctggaaatggtaaaaaaataaaaccaaactgggaaattctaatagaaacacatataaaatattacagagactcgaactcttttttgctgccaaaaagaaagtgaaaattgatagaatgtcaacttttttttaaacaagataattagaaaatcaaatagataaccggcaaattcaacaatataaattcaaaaaattcaaaaaattaacgaaattcaacatttcttcgatgatccagcagatccaggagcaaaacaagaattcgtaagtccaagttcttcttcttgcatttcagcagcaagttgtttgaatgcttctcgttcttctggtgtcaatgtatttaaaagttcatcaatatcatctgacaatccaagagttgtcattcgtctctcaatttctccatcttctaactcatactcatcaattgttccttgaatcgtttttttcattgcttcagtgtcctctttctgccagtcagccacgtcttcttgctcttcatcatcagaatcaagtggctcgccttctgtaaattaatttacaatttttgagctcacaaataaaatctcaccttcaattccactccaatctccatccaaaaacttttg