Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F43E2.7   

sjj_F43E2.7 RNAi JA:F43E2.7
Simmer:F43E2.7
PCR_productsjj_F43E2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F43E2.7a Source_evidenceePCR819WS150 Sequence/Annotation Release
F43E2.7b Source_evidenceePCR198WS150 Sequence/Annotation Release
Overlaps_Gene F43E2.7 (3)
Overlaps_transcript F43E2.7a Source_evidenceePCR819WS150 Sequence/Annotation Release
F43E2.7b Source_evidenceePCR1003WS150 Sequence/Annotation Release
WB_DNA_textsjj_F43E2.71194gatgaagttggggacgaaaatcttatgcaaagtaagagttgctagcgtaaagttgttgatccacgccgacagtgacagctcccacttgttcacgaaggaacaggcggtttccacgcttgagaccaattgggcgaaggtagtcccatgctccatgccagttgttgaaggatggtgaatatgggaggaacgaaacggctagtcctgaaataatcttttattttaaaagatactgttattcgcatgcttacctgatccagcaacagccataacagtggatacaacactgtatgggtagccgaaggagttgacgaggaatggaacagcagtatggatgaacttgtgaacatccttggcagccttggctttcgtttcgtccttattctttgtgtctccaaattcaatgcggagaatagctctttgaattccgtgagtaattagatgaactccccaaatgacgagaagctctccaacgatctgaggagcaagtccgctgaaaagtcctcctggaccttcctgctttccgatgacggccagagcctgggcgcaggtagtgtatttagtttcattgccaataacttgagcaacttgacgagcaaagcagactggaagagattattatacagtttaatcgcaaataatttaacttaccagcaaatggtcgtgcagcagtaacagcaacaacacgaatgacagaatcgcggaatccgttacgaataactcttcggaatgattcagcatcggtgagttcatcctcttctttatcttgatttaaaagaggtcctccaatattggggtagtactcgtcgatgtactgtaagataattttttacggttttcaggaactttcaatgagaaaactgtttacctgctgagtgcggtgagaagcaataccctgaacagccaaagcagcgatagcagagtcgattccagtccaaagggtgatatatccacgagtagttcccaattgcttcactaaatttatgatcattaccgaagattattttcgtgaatcctactatagctgaagaagttaggaaggaaatacgcatttcttcctgcaatgacgagagtctttcctgtagacaatgggaacggttcatgaccaagctggataagggtacgtgtcacggtcaaaggaagcgacaacgagctcaaagcgagcttggcaataagactcttggcgaatttctcctg