Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F43G9.2   

sjj_F43G9.2RNAiJA:F43G9.2
PCR_productsjj_F43G9.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43G9.2 Source_evidenceePCR538WS150 Sequence/Annotation Release
Overlaps_Gene F43G9.2 Source_evidenceePCR538WS150 Sequence/Annotation Release
Chunk_score Abs_score433
Max_abs_score433F43G9.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86098138610766
Overlaps_transcriptF43G9.2 Source_evidenceePCR538WS150 Sequence/Annotation Release
WB_DNA_textsjj_F43G9.2954ctgtacttgtgtctgcgtctctgatttatacacgatgtttttaagtgtctcgtggattttgacaacttcgaaaaatacattttatttttatttatttaattttcagtaaaatggcaatgaaagaaggcagctcagtggagcaatttgcaatgagaagtcgtgcagcaaggacttcatcgagtgaaggtttccaaaacgatatgcccacatacaaggatgtagtttttattgaaagaaaagtaaaaaacggcgatacactcaataaattggcaataaaatatcaagtaaatgtgagttctgtcggtttcaataaaatattttatttgcaatatttttcaggtagccgaaataaaacgagtgaataatatggtatccgagcaagattttatggcactttcaaaagtgaaaattccagttagccgaatgagaatggcgttaggcgtacaatcggctttaagccaagacgaagaagacgaaattcttattggttagtttttttttgctgagataaagctttaatttctaaagatttacagatattgatgacagaactgcacttctgcgagaagatcgaggctcacgagatcccagtgtcgaggatattttccataaaactgatactaacataggtgaataaaagttaataaaaattattaaaaaacaaatagaaaaatttcagctcaagttcgagaagctcttccagaagaaagtcacggtgtcactggttttcattttgtaaccgctcgagccccaacttcgtcatctatttctgtttggatggttgttttaggtaggttttttctttcttggtcgtataaaaatgtcaaatctttgatatttgagaattcattttttcaggagttctcttgatcttctgtgtacttcctttggtgcttaccttctacgaagagcaagaagaagccgctcatcaacataagactacacatgccgctt