Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F43G9.3   

sjj_F43G9.3 RNAi JA:F43G9.3
Simmer:F43G9.3:Repeat_b
Simmer:F43G9.3:Screen_A
Simmer:F43G9.3:Screen_B
PCR_productsjj_F43G9.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43G9.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
Overlaps_Gene F43G9.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
Chunk_score Abs_score651
Max_abs_score651F43G9.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI86131478614750
Overlaps_transcriptF43G9.3 Source_evidenceePCR813WS150 Sequence/Annotation Release
WB_DNA_textsjj_F43G9.31604ttggtcctttcagccaattcatgctcaatcctttgtacaatcctcgtttcaaaccctctgaaaatttgatgtttttgtattgtttgctgtatagtttattctagtaaagcccactcaaatattgtgaattgttcggagttttatgtgtagctataaaaaattactttagaaattccaaaatcttgttttagaggtggacggcggcaattattgaaaaatcataaatattgcgccatgttcaccccatatattttttttagaaaatcgtagtatagaaaatcacttaaattatccaaaaagttgatatttgcccaaaaacaaagttagataactcgataatcagtaattgacaactttcagatcatttttaagcactttctcaaatttttcaactggaattaatttgattttcggacacatcaagtgattttctatactttgacattgaatttcaattaaaaaaatgttggaacaagcaggttattttgtttaattgcaaccgcccatttctgatagaactatattgtcattatagtaaggtttaaaaaaaactataattcaaaaaatagtcatacccgtatgataaatatgaattagagctctaagaggactccatccactcggaattcgccctgtttgcatccgccttctcacaatatcgagtggatatgacgatgattgaccgatcaaaccagctaacattccaaataacattcggtagtaggaattttcctgaattatcatacataataacgtatagaaataatttctcaactcacaacttcacctctatgatctcgatacataatcttaagagtttcgtatgtgaagaaggaagatccagcgtatggtattactcctgtaatcaacaaaaatcgataagaaagatgtttttcataagaattcctacctagtatagttggataaatccctctgtacaatagttgaataccaccttctttatatgtttttacaaaaacatgtttcaaagaactatattgtaattttgaagagactgaaagacgagcttttgcggtgtctaaaggataagtgatcattgtagctgttgtggcggcaagagaacctgttatatatcgtttcacgggtgttcgacttctggaaattaacattttgaagttaaatttgccacctcggtgtgaaaaaaactttaaaactcacccattttcgtcaactttcagcaattttttatactgctcgaaggctgcgaattgcatcgacgcgtatggcacaacacgagccatcgtcgcagaatttccacgatacaatgcaaagaatccattttcccgatatgttagttttatgaatttaatggcagatcggaatgagtaaccacgtgtacttgaaactggaacatacaaaaaattaggtgtattttcgattgtttcgaagtgacataattcttaccttgaaaataaattttagttcgatccaaaggtgcgattgtagttttggctaaagctccggcgatcgcgcctgcggatagtgacaaaacgacactgggcctctgttttccctgaaaatatgattttatgacagagatgttccaaaatttatttaaaatcttacctcatttgagtcgtgcg