Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F44A6.2   

sjj_F44A6.2 RNAi JA:F44A6.2
Simmer:F44A6.2
PCR_productsjj_F44A6.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44A6.2 Source_evidenceePCR818WS150 Sequence/Annotation Release
Overlaps_Gene F44A6.2 Source_evidenceePCR818WS150 Sequence/Annotation Release
Chunk_score Abs_score755
Max_abs_score755F44A6.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1020173010202658
Overlaps_transcriptF44A6.2 Source_evidenceePCR818WS150 Sequence/Annotation Release
WB_DNA_textsjj_F44A6.2929ttggaacatttccacaacgagaggaggcaggtttaaaaacgacaaattttctcgaagaatattgagttgctgtttatgtagctcatctggaaaaagttgatataaaataaaacaaaatatcagtatgaaatacaacttactaagtcgattcaattcatgaatacatttcataagttgtttgtatgtatcgcatccgtcaatgcggcatgtcattttttggaaaagaactttcttgtaaaaatcaaacatttccagcaactgcaattgacttttgaagttagtagaaaattgttgttccgtggttagtggctggcaaagaataaggacaatgaatagtgcaatatctccgtctgtacatccaattgtaatgatatggtttgcaaatgcaagcatttcgtccgccaatgatccatagagcagttgaagagacttaaagtcaatgagtcttccatctcgaagcataagccctctgttcgacattccacgaacaatgcgaagcaagtagagtgggaaagcgtttttcctgagtaaaactgctttgtcgtttccgttaatgaaattaaattttggaatttctttcacaaagtttacaacttccttgatgtccacgtcaatttcatgagcataaatctgccaggcattcaatcgattcatttttgagtcttcattgattctctgaaacattttaacgtttagtatgattttaaaaacatgcccaaaagttacttacgacattgaatggtcttgcaacaatacttcggattttaatgtcagtgtaaaatgagaaggtagtgtgtgctcggagtacagcttcatatacggcgtcaacttcttcttgccgttctagcgttgagatttccggaacaaaaacggaatcggggctcttatcatctcgcattgcatttctgaacttcatttggcgaacagct