Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F44E5.1   

sjj_F44E5.1 RNAi JA:F44E5.1
Simmer:F44E5.1
PCR_productsjj_F44E5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F43G6.9 Source_evidenceePCR208WS150 Sequence/Annotation Release
Chunk_score Abs_score208
Specificity_index0.459
Rel_score0.849
Map_statusTop50_percentile_ePCRII1177411011774784
F44E5.1 Source_evidenceePCR310WS150 Sequence/Annotation Release
Chunk_score Abs_score247
Max_abs_score247F44E5.1
Specificity_index0.541
Rel_score1
Map_statusBest_ePCRII1177411011774784
Overlaps_transcript (4)
WB_DNA_textsjj_F44E5.1675accgacaaatctggacaaaactattgtccaataaaagaaaattaaaccaaatctaggtgcatccgactgaattagtgatgagctggggcggcagcagcgacgttggcgatggccttggcagcttttctctcggcgcgggcaatttcggcctgaaaatgaacaattttttttgagaataacaatagggaaacgctttacctttctgttctggttccacttgaacatgtagtacatcccaacgtagctcaagagggcggcacggcagatgttggcacgtccgaaatgctcgtgtgggttgaggtagagtctcttggtttggacgattgattgccaaattccacgaacggtgtctgccatctaaaacggaatgattggaaacaatttttgacattgagaacagaatttagaaaataataccggaaagaaaaccgattactcgacaaagacatcattaaaataaatgaataaataataatatttatgaatatttctttggcaaaataagaattgtgaggtgggattacaatatatgttttttacctaatacaatattaaataaagtaatattaggagagaatattagacacgtatattacgcaatatataatgatatcgaatatcgagcttgggataagttagcatgtgacaagaaccaacatcaagtttcacagacaa